بررسی ارتباط پلی مورفیسم ژن TNFR1 با ناباروری ایدیوپاتیک مردان

نوع مقاله: علمی - پژوهشی

نویسندگان

1 دانشگاه گیلان، دانشکده علوم، گروه زیست شناسی، رشت، ایران

2 دانشگاه علوم پزشکی گیلان، دانشکده پزشکی، رشت، ایران

چکیده

هدف: در مطالعه حاضر، ارتباط پلی مورفیسم TNFR1 36A/G با ناباروری ایدیوپاتیک مردان در جمعیت گیلان بررسی شد. مواد و روش‏ها: این مطالعه شامل 106 مرد نابارور ایدیوپاتیک و 114 مرد بارور به‏عنوان گروه کنترل می باشد. نمونه خون تهیه و DNA ژنومی استخراج شد. سپس ژنوتیپ‏ها و فراوانی آللی با استفاده از روش PCR-RFLP ارزیابی و آنالیز آماری با استفاده از نرم افزار  MedCalc  انجام شد. نتایج: فراوانی ژنوتیپ‏های AA, AG, GG بیماران به‏ترتیب برابر 9/50، 5/7 و 5/41 درصد و نمونه‏های کنترل به‏ترتیب برابر 1/21، 3/33 و 6/45 درصد بود. فراوانی نسبی آلل A و G بیماران به‏ترتیب برابر 45/0 و 55/0 بود و نمونه‏های کنترل به‏ترتیب برابر 62/0 و 38/0 بود. نتایج نشان داد در فراوانی ژنوتیپی(P=0.002)  و آللی (P=0.0004) گروه‏های نابارور و کنترل ارتباط معنی‏دار دیده می‏شود.  نتیجه گیری: در نتیجه، به‏نظر می‏رسد در استان گیلان افراد با آلل G و ژنوتیپ GG بیشتر در معرض خطر ابتلا به ناباروری ایدیوپاتیک می‏باشند. مطالعات دیگری با تعداد بیشتری از بیماران جهت نشان دادن نقش پلی مورفیسم ژن TNFR1 در ناباروری مردان مورد نیاز است.  

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

ناباروری می‏تواند موجب تنش‏های روحی- اجتماعی- اقتصادی در افراد نابارور اجتماع شود. سالانه 60 تا 80 میلیون زوج مبتلا به ناباروری در جهان شناسایی می‏شوند (1). درمان ناباروری در مردان مشکل‏تر از زنان است، به‏خصوص در کشورهای در حال توسعه که به‏دلیل هزینه بالا، افراد کمی برای درمان اقدام می‏کنند (2). تقریبا 15 درصد از زوج‏ها نابارور هستند. تشخیص عوامل ناباروری برای زوج‏ها و پزشکان، زمینه‏ای برای شروع تحقیقات و درمان است. ناباروری، به‏عنوان عدم بارداری پس از 12 ماه مقاربت محافظت نشده تعریف می‏شود. در سال‏های اخیر در زمینه درمان‏های کمک باروری پیشرفت‏های متعددی وجود داشته و با این وجود، در حال حاضر بیش از 80 درصد از زوج‏ها که نابارور هستند می‏توانند به داشتن فرزند امیدوار باشند (3). ارزیابی مناسب ناباروری زمانی است که به بررسی وسیعی از عوامل قابل شناسایی احتمالی درهر دو زوج پرداخته شود (4).

عوامل محیطی و غیر ژنتیکی در ایجاد ناباروری مردان نقش دارند. از عوامل عمده غیر ژنتیکی مانند عفونت‏های (باکتریایی) مایع منی، بیضه‌ها و مجاری تناسلی، واریکوسل، کریپتورکیدیسم، هیپوگنادیسم و غیره مواردی هستند که ناباروری مردان را موجب می شوند (5). از مهم‏ترین عوامل موثر بر ناباروری مردان واریکوسل، الیگو اسپرمی، آزواسپرمی می‏باشد. سایر عواملی دخیل در ناباروری مردان دخیل اند شامل: انسداد مجرای اسپرم بر، اختلالات جنسی، اختلالات ژنتیکی، اختلالات کروموزوم (کاهش یا تولید نکردن اسپرم) اعتیاد به مواد مخدر از جمله مصرف سیگار، الکل، کوکائین می‏باشد (6). ناباروری ایدیوپاتیک شرایطی است که در باروری اختلالاتی خود به‏خودی و یا به‏علت مبهم یا ناشناخته رخ می‏دهد که حدود 30 تا 50 درصد از موارد ناباروری مردان را تشکیل می‏دهد (7). عوامل ژنتیکی حدود 15 درصد از ناباروری در مردان را موجب می‏شود (8 و9). پلی مورفیسم تک نوکلئوتیدی فراوان‏ترین نوع تغییرات در ژنوم انسان است و می‏تواند برای شناسایی ژن‏هایی که مسبب یا مستعد ابتلا به بیماری‏های پیچیده انسانی هستند، مورد استفاده قرار بگیرد (10). ژنتیک با تاثیر بر انواع فرآیندهای فیزیولوژیکی از جمله تعادل هورمونی، اسپرماتوژنز و کیفیت اسپرم موجب ناباروری مردان می‏شود. تعدادی از ژن‏ها ازجمله ژن فاکتور آزواسپرمی (zoospermia factor=AZF)، ژن هورمون جنسی متصل به گلوبولین (Sex hormone binding globulin=SHBG)، ژن گیرنده آندروژن (Androgen receptor=AR) و ژن فاکتور نکروز دهنده تومور آلفا (Tumor necrosis factor-α=TNF-α) و بعضی ژن‏های دیگر در ناباروری مردان دخالت دارند (11).

التهاب جزء اصلی پاسخ ایمنی به پاتوژنزها و آسیب دیدگی‏های سلولی است. محرک‏های قوی التهاب شامل عوامل عفونی، فاکتورهای مکانیکی، رادیکال‏های اکسیژن، پروتئین شوک حرارتی (Heat shock protein= HSP) می‏باشند. هنگامی‏که پاسخ التهابی، مکانیزم‏های دفاعی برای عوامل آسیب رسان به سلول‏های آسیب دیده آماده می‏کند، به سلول‏های سالم موجود در جایگاه التهاب هم خساراتی وارد می‏شود. فاکتورهای التهابی شامل سیتوکین‏هایی مثل اینترلوکین‏ها و اینترفرون‏ها و فاکتور نکروزی تومور آلفا (TNF-α) هستند (12). TNF-α با اتصال به گیرنده‏های خود، چندین مجموعه مسیرهای سیگنالینگ منجر به آپوپتوزیس و التهاب و تمایز سلولی را تنظیم می‏کنند. عمدتا توسط ماکروفاژها و لنفوسیت‏هایT، همچنین توسط سلول‏های مختلفی از جمله سلول‏های کشنده طبیعی(Natural killer) ، ماست سل‏ها و فیبروبلاست‏ها تولید می‏شود. کاهش فعالیت TNF در پاتولوژی بسیاری از بیماری‏های خود ایمنی نقش دارد (13). اصطلاح فاکتور نکروز دهنده تومور آلفا (TNF-α)  در سال 1975 توسط Carswell و همکاران او در حالی‏که نکروزیس هموراژیک توسط آندوتوکسین را مطالعه می‏کردند اطلاق شد، این فاکتور یک گلیکوپروتئین است و در پاسخ به آندوتوکسین تولید شده و ظرفیت برای از بین بردن تومور دارد (13). اثرات TNF-α با اتصال به گیرنده‏های آن یعنیTNFR1  و  TNFR2انجام می‏شود. این دو گیرنده با وجودِ داشتن تفاوت‏هایی اما در فرآیندهای سیگنالینگ پایین دست خود با همدیگر واکنش می‏دهند. بررسی‏ها روی TNFR1 و  TNFR2 نشان می‏دهد که  TNFR1 بیشتر در تکثیر سلولی، التهاب، و فعالسازی مسیر آپوپتوز دخیل است، درحالی‏که نتیجه‏ی مسیر سیگنالینگ TNFR2  ممکن است موجب ترمیم بافت و رگ باشد (14).

TNFR1 به‏دلیل توانایی در القای مرگ سلولی از طریق یک موتیف اسید آمینه ای در دومین‏های سیتوپلاسمی شناخته شده که به اصطلاح توالی مرگ  (Death domain= DD)نامیده می‏شوند. پس از اتصال TNF-α به TNFR1 پروتئین آداپتور داخل سلولی به‏نام پروتئین متصل به دومین مرگ (TNFR-associated death domain) به جایگاه مرگ در گیرنده متصل می‏شود و در نهایت منجر به فعال شدنcaspase  ها شده و مرگ سلول (آپوپتوزیس) رخ می‏دهد. در روش دیگر، TRADD (TNFR-associated death domain) با اتصال به TNFR1 می‏تواند موجب اتصال مهار کننده سلولی آپوپتوزیس (Cellular inhibitor of apoptosis protein= CIAP) و یا پروتئین واکنش دهنده با گیرنده (Receptor interacting protein= RIP) شود، این مسیر منجر به فعال شدن مسیرNFκB  می‏شود. بنابراین TNFR1 دارای قابلیت سیگنالینگ دوگانه برای هر دو مسیر یعنی مرگ سلولی و حیات سلول است (15).

سیتوکین‏های التهابی نقش مهمی در فیزیولوژی تولید مثل دارد (16). حذف ژن TNF-α باعث کاهش وزن بیضه و کاهش تولید اسپرم می‏شود (17). TNF-α بر غلظت اسپرم تاثیر می‏گذارد و با محدود کردن سیستم لیگاندی Fas، از آپوپتوزیس سلول‏های جنسی جلوگیری می‏کند و نسبت مطلوب بین سلول سرتولی و سلول‏های زایا را بر هم می‏زند در حالی‏که همه این‏ها به‏ترتیب برای انجام میوز و آزاد سازی اسپرماتوزوآ به‏داخل لوله اسپرم ساز و برای تولید اسپرم سالم ضروری است. میزان بالای TNF-α اثرات منفی روی تولید تستوسترون دارد که این مسئله برای حفظ اسپرماتوژنز طبیعی خیلی مهم است. افزایش مقدار TNF-α در مایع اسپرمی، با تخریب DNA اسپرم و کاهش تعداد اسپرم‏هایی که میتوکندری فعال دارند، موجب کاهش حرکت اسپرم می شود (17و18).

هدف از این تحقیق بررسی ارتباط پلی مورفیسم ژن TNFR1 با ناباروری ایدیوپاتیک مردان درجمعیت استان گیلان بود.

مواد و روش‏ها

مطالعه‏ی حاضر مطالعه ای مورد- شاهدی است در آن 220 فرد طی آبان ماه تا اسفندماه 92 مورد آزمایش قرار گرفتند که از این تعداد 106 بیمار مبتلا به ناباروری ایدیوپاتیک و 114 مرد سالم به‏عنوان شاهد (‏با داشتن فرزند زیر 5 سال) بودند. دامنه‏ی سنی مردان نابارور ایدیوپاتیک وسالم در این پروژه 24 تا 45 سال بوده است. 3 میلی‏لیتر خون از این افراد تهیه کرده و در ونوجکت‏های حاوی EDTA ریخته شد. نمونه‏ها به‏مدت چندین ماه در دمای 20- درجه سانتی‏گراد نگه‏داری شدند. همه افراد مورد مطالعه ساکن استان گیلان بودند و طی پنج ماه از بیمارستان الزهرا و آزمایشگاه رازی رشت توسط متخصص اورولوژی ارجاع داده شده بودند.

استخراج DNA ژنومی توسط کیتDNG-PLUS  صورت گرفت. نمونه خون با solution –GPP مخلوط شده و سپس در بن ماری (دمای 70 درجه سانتی گراد) قرار داده شد. سپس زیر هود، NaCl و کلروفرم به محلول اضافه شده و در داخل دستگاه سانتریفوژ (در دور rpm5000 به‏مدت 5 دقیقه) قرار داده شد. بعد از پایان سانتریفوژ 3 فاز ایجاد شد، فاز بالایی آبی را برداشته در میکروتیوپ دیگری ریخته و در دو مرحله پیاپی به آن الکل 70 و 100 درصد اضافه شد و هر بار (دور rpm 6000 و به‏مدت 5 تا 10 دقیقه) سانتریفوژ شد. محلول رویی را دور ریخته و میکروتیوپ به‏مدت 10 دقیقه به‏صورت واژگون در دمای محیط قرار داده شد سپس به میکروتیوپ, آب مقطر استریل اضافه شد تا DNA با آب مخلوط شود سپس DNA به یخچال منتقل شد. برای بررسی کیفیت DNA استخراجی از ژل الکتروفورز افقی استفاده شد. ژل مورد نظر به دستگاهGel-Doc  منتقل و با استفاده از نورUV عکس‏برداری از آن صورت گرفت. برای بررسی پلی مورفیسم مورد نظر، DNA ژنومی به‏روش PCR تکثیر شد. باتوجه به پلی مورفیسم یاد شده که حاصل تبدیل نوکلئوتید آدنین به گوانین در اگزون شماره 1 ژن TNFR1 بود؛ دو جفت پرایمر رو به جلو (Forward) و رو به عقب (Reverse) طراحی و تهیه شدند. توالی‏های الیگو نوکلئوتیدی پرایمرهای Forward و Reverse برای تکثیر قطعه 222 به‏ترتیب  CGTGATCTCTATGCCCGAGTCT و CAGCCCACTCTTCCCTTTGTC بود. PCR به‏کمک دستگاه ترموسایکلر Bio-Rad و در میکروتیوپ‏های 2/0 میلی‏متری حاوی  Templet DNA 3μl،Forward primer  1 μl، Reverse primer 1 μl، Tag master mix 2x 10 μl و آب مقطر  5 μl انجام شد. اجزای master mix شامل 0.08 unit/μl Taq DNA polymerase در بافر، 3 mM MgCl2، 0.4 mM dATP ،0.4 mM dCTP ، 0.4 mM dGTP، 0.4 mM dTTP است.

بعد از تکثیر قطعه‏ی مورد نظر، جهت بررسی قطعات تکثیر شده الکتروفورز افقی روی ژل آگارز 2 درصد انجام شد. در این پروژه جهت بررسی پلی مورفیسم A/G در ژن TNFR1، روش(RFLP)  Restriction Fragment Length Polymorphism استفاده شد. آنزیم برشگر به‏کارگرفته شده در این روش BSRI می‏باشد. در جدول 1 ویژگی‏های این آنزیم آمده است.

جدول1: ویژگی های فعالیت آنزیم  BSR1

قطعات

جهش

جایگاه برش

آنزیم

222

A/G

 

BSRI

براساس نتایج حاصل از برش آنزیم BSRI، محصول PCR افراد سالم و بیماری که در ژن TNFR1 خود جهش (A/G) را نداشته و مورد هضم آنزیمی قرار گرفته اند در ژل آگارز به‏صورت دو قطعه مجزا باقی می‏ماند (قطعات 30 و 192 جفت بازی) بنابراین این افراد دارای ژنوتیپ هموزیگوت (AA) می‏باشند. افراد سالم و بیماری که محصول PCR آن‏ها در نتیجه‏ی هضم آنزیمی به‏صورت Uncut باقی می‏ماند (یک قطعه ی 222 جفت بازی) در ژن TNFR1 خود دارای جهش مزبور بوده اند بنابراین این افراد ژنوتیپ هموزیگوت (GG) دارند. همچنین افراد سالم و بیماری که محصول PCR آن‏ها در نتیجه‏ی هضم آنزیمی در ژل آگارز به‏صورت سه قطعه به طول های 30 و 192 و 222 جفت بازی ظاهر می شوند، دارای ژنوتیپ هتروزیگوت (AG) هستند.

آنالیز آماری

آنالیز آماری با استفاده از نرم افزار MedCalc (Version. 12.1.4.0) صورت گرفت. جهت بررسی معنی‏دار بودن تفاوت بین ژنوتیپ‏ها در دو گروه بیمار و کنترل از آزمون Chi-Square استفاده شد و 05/0 p≤  به‏عنوان سطح معنی‏دار بودن اختلاف بین دو گروه در نظر گرفته شد.

نتایج

در این تحقیق در مجموع 220 نفر شامل 106 مرد مبتلا به ناباروری ایدیوپاتیک و 114 مرد سالم به‏عنوان گروه کنترل مورد بررسی قرار گرفتند. برای بررسی وجود پلیمورفیسم در ناحیه 222 ژن TNFR1 نمونه DNA افراد بیمار و کنترل تحت اثر آنزیم BSRI قرار گرفتند. در شکل 1 نمونه DNA استخرج شده از افراد بیمار و سالم روی ژل آگارز 1 درصد و در شکل 2 محصولاتPCR  قطعه ی 222 جفت نوکلئوتیدی روی ژل اگارز 2 درصد نشان داده شده است.

 

 

 

شکل1: نمونه DNA استخراج شده از افراد شاهد و بیمار

 

شکل2: محصول PCR ژن TNFR1 در افراد شاهد و بیمار. طول قطعه تکثیر یافته 222 جفت باز بوده که محل قرارگیری آن با فلش در سمت راست نمایش داده شده است. M  مارکر 50 جفت بازی است.

 

در شکل3 و 4 تصاویر مربوط به PCR-RFLP آورده شده است.

 

 

شکل3: هضم انزیمی محصول PCR افراد شاهد در ژل الکتروفورز افقی. نمونههای1و6 هتروزیگوت AG است (222bp/192bp/30bp). نمونه 4 هموزیگوت GG (222bp) و نمونههای 2و3و5 هموزیگوت AA است (192bp/30bp). پیکانهای سمت راست محل باندها را نشان می‏دهد. M مارکر50 جفت بازی است.

 

 

شکل4: هضم آنزیمی محصول PCR افراد بیمار در ژل الکتروفورز افقی. نمونه‏های1و4 هموزیگوت AA (192bp/30bp) و نمونه 2و3 و5 و6  هموزیگوت GG است (222bp). پیکان‏های سمت راست محل دقیق باندها را نشان می‏دهد. M مارکر50 جفت بازی است.

 

بعد از عمل هضم آنزیمی و بردن محصول آن روی ژل، نتایج ژنوتیپی و آللی در جدول‏های 2 و 3 به‏دست آمد.

 

جدول2: توزیع ژنوتیپی پلی مورفیسم 36A/G ژن TNFR1 در افراد بیمار و کنترل

 

P- Value

 

95% CI

 

Odds Ratio

 

 

Controls

n (%)

 

Patients

n (%)

 

Genotype

 

-

 

-

 

Ref (1.00)

 

52 (45.6%)

 

44 (41.5 %)

 

AA

 

0.002

 

0.10-0.58

 

0.24

 

38 (33.3 %)

 

8 (7.5 %)

 

AG

 

0.002

 

1.42-4.97

 

2.65

 

24 (21.1 %)

 

54 (50.9 %)

 

GG

 

جدول3: توزیع آللی پلی مورفیسم 36A/G ژن TNFR1 در افراد بیمار و کنترل

 

P- Value

95% CI

Odds Ratio

Controls

N

Cases

n

Allele

-

-

Ref (1.00)

0.62

0.45

A

0.0004

1.36 – 2.91

1.99

0.38

0.55

G

 

 

باتوجه به نتایج به‏دست آمده در جدول های 2 و 3 در بین افراد بیمار فراوانی ژنوتیپ‏های GG،  AGو AA به‏ترتیب 9/50، 5/7 و 5/41 درصد می‏باشد در حالی‏که در افراد سالم به‏ترتیب برابر با 1/21، 3/33 و 6/45 درصد می‏باشد. تفاوت مشاهده شده بین افراد سالم و بیمار با توجه به آزمون  Chi-Square(P= 0.002) از لحاظ آماری معنی‏دار بود و افرادی که دارای این ژنوتیپ هستند 6/2 برابر بیشتر از سایرین درمعرض ابتلا به ناباروری ایدیوپاتیک قرار دارند (Odds ratio= 2.65, 95%CI= 1.42-4.97). در رابطه با فراوانی آللی هم نتایج نشان دادند که در بین افراد بیمار فراوانی آلل‏هایA  و G به‏ترتیب برابر با 2/45  و 7/54 درصد و در افراد سالم به‏ترتیب برابر با 38 و 62 درصد می‏باشد. طی آنالیزهای آماری مربوط به فراوانی آللی ژن TNFR1 مقدارP=0.0004  به‏دست آمد و با توجه به مقدارOdds ratio، آلل G به‏عنوان یک فاکتور خطر برای ابتلا به این بیماری شناخته شد در نتیجه افرادی که دارای این آلل هستند 99/1 برابر بیشتر از سایرین درمعرض ابتلا به ناباروری ایدیوپاتیک قرار دارند (Odds ratio= 1.99, 95%CI= 1.36-2.91). در نتیجه نشان داده شد که تفاوت معنی‏داری بین ژنوتیپ‏ها و آلل‏ها، در این دو گروه وجود دارد و ژنوتیپ GG وآلل G به‏عنوان فاکتور خطر برای ابتلا به ناباروری ایدیوپاتیک هستند.

 

بحث

عوامل مربوط به ناباروری شامل سن، قرار گرفتن در معرض بیماری‏های مقاربتی و فرکانس مقاربت و همچنین عادات رژیم غذایی، شیوه زندگی و ژنتیک است. ناباروری به‏عنوان یک بیماری مطرح شده و علت آن اختلال عمده ی سیستم‏های اندام‏های اصلی و فعالیت‏های زندگی محسوب می‏شود (4). در ابتدا نقشTNFR1 به‏عنوان گیرنده‏ی ژن TNFα که یک سیتوکین پیش التهابی است، مورد توجه قرار گرفت. بیان این ژن در دستگاه تناسلی زن و مرد نشان می‏دهد که آن‏ها در باروری نقش دارند (19). همچنین برای انجام اسپرماتوژنز، حضور TNFα بسیار ضروری است (20). TNF-α، اسپرماتوژنز را تحت تاثیر قرار داده و موجب ارتباط میان سلول‏های محتلفی در بیضه شده و تنظیمات هورمونی هنگام مهاجرت سلول‏های زایا را انجام می‏دهند. اگر چه سیستم ایمنی بدن ممکن است منبع اصلی تولید سیتوکین باشد، اما سلول‏های مختلف دیگر در دستگاه ادراری– تناسلی مردان نیز سیتوکین‏ها را ترشح می‌کنند که بر عملکرد اسپرم و باروری موثر هستند (21).

با توجه به چند­عاملی بودن ناباروری تاکنون نقش ژن‏های مختلفی در ایجاد آن مورد بررسی قرار گرفته که یکی از این ژن‏ها TNFR1 می‏باشد. Lazaros و همکاران TNFR1 (17) را به‏عنوان یک فاکتور خطر در استعداد ابتلا به ناباروری معرفی کردند. Tronchon و همکاران (22) در کشور فرانسه دریافتند پلی مورفیسم ژن TNF-α با کاهش مقدار اسپرم ارتباط دارد. همچنین Zalata و همکاران (20) طی تحقیقاتی که روی پلی مورفیسم ژن TNF-α انجام دادند دریافتند که موجب ناباروری در مردان می‏شود. با توجه به نقش مهم گیرنده‏های TNF-α و پلی مورفیسم‏های آن در بسیاری از بیماری‏ها مانند اختلالات عصبی، اوتیسم، آلزایمر و برخی بیماری‏های مربوط به زنان مانند اندومتریوز و... در این پژوهش به بررسی ارتباط پلی مورفیسم ناحیه 36A/G ژنTNFR1  با ناباروری ایدیوپاتیک مردان پرداخته شد. در پژوهش کنونی تفاوت معنی‏داری بین جمعیت بیمار و کنترل در توزیع فراوانی ژنوتیپی (P= 0.002, Odds ratio= 2.65, 95%CI= 1.42-4.97) و توزیع فراوانی آللی (P= 0.0004, Odds ratio= 1.99, 95%CI= 1.36-2.91) مشاهده شد. این نتیجه محدود به جمعیت مورد مطالعه حاضر(114 مرد سالم و 106مرد مبتلا به ناباروری ایدیوپاتیک) می باشد. نتایج پیشنهاد می‏کند که پلی مورفیسم TNFR1 36A/G به‏عنوان فاکتور خطر برای ناباروری ایدیوپاتیک مردان مطرح می‏باشد. اگرچه مطالعات بیشتر درمورد ژنTNFR1 جهت درک بهتر نقش این ژن در ناباروری ایدیوپاتیک مردان مورد نیاز می‏باشد.

در مجموع، شاید بتوان نقش ژنتیک را در ارتباط با پلی مورفیسم و استعداد ابتلای به ناباروری ایدیوپاتیک موثر دانست اما نتایج متفاوت در بررسی پلی مورفیسم‏های ژنی می‏تواند به‏علت خزانه ژنی متفاوت، میزان جمعیت مورد بررسی و تکنیک‏های مورد استفاده باشد و ممکن است نتیجه‏ی به‏دست آمده با تغییر خزانه‏ی ژنتیکی یا تغییر معنی‏دار اندازه‏ی جمعیت تغییر کند. در این مطالعه تنها به بررسی یک وجه از یکی از عوامل دخیل پرداخته شده لذا همچنان نقش سایر ژن‏ها، عوامل محیطی و حتی سایر پلی مورفیسم‏های شناخته شده در ژن مورد مطالعه، در ایجاد و بروز ناباروری قابل تامل و دخیل است.

 

نتیجه گیری

به‏طور کلی نتیجه گیری می‏شود که پلی مورفیسمTNFR1 36A/G به‏عنوان فاکتور خطر برای ناباروری ایدیوپاتیک مردان در جمعیت استان گیلان مطرح باشد.

تشکر و قدردانی

از آزمایشگاه تکوین دانشکده علوم پایه دانشگاه گیلان به‏دلیل فراهم آوردن تجهیزات، از همکاری کارکنان بخش ناباروری بیمارستان الزهرا (س) و همچنین آزمایشگاه رازی رشت در تهیه نمونه‏ها صمیمانه تشکر می‏شود.

  1. Poongothai J, Gopenath TS, Manonayaki S. Genetics of human male infertility. Singapore Med J. 2009; 50(4): 336-47.
  2. Bayasgalan G, Naranbat D, Radnaabazar J, Lhagvasuren T. Male infertility: risk factors in Mongolian men. Asian J Androl. 2004; 6(4): 305-11.
  3. Volarevic V, Bojic S, Nurkovic J, Volarevic A, et al. Stem Cells as New Agents for the Treatment of Infertility: Current and Future Perspectives and Challenges. Biomed Res Int. 2014; 507234.
  4. Damario MA. General aspects of fertility and infertility. Methods Mol Biol. 2014; 1154: 3-23.
  5. Imamovic Kumalic S, Pinter B. Review of Clinical Trials on Effects of Oral Antioxidants on Basic Semen and Other Parameters in Idiopathic Oligoasthenoteratozoospermia. Biomed Res Int. 2014(6); 426951.
  6. Olooto WE. Infertility in male; risk factors, causes and management- A review. Journal of Microbiology and Biotechnology Research. 2012; 2(4): 641-645.
  7. Al-Achkar W, Wafa A, Moassass F. Cytogenetic abnormalities and Y-chromosome microdeletions in infertile Syrian males. Biomed Rep.  2013; 1(2): 275-279.

8. Zaimy MA, Kalantar SM, Sheikhha MH, Jahaninejad T, et al. The frequency of Yq microdeletion in azoospermic and oligospermic Iranian infertile men. Iran J Reprod Med. 2013; 11(6): 453-8.

9. Ambulkar PS, Sigh R, Reddy M, Varma PS, et al. Genetic Risk of Azoospermia Factor (AZF) Microdeletions in Idiopathic Cases of Azoospermia and Oligozoospermia in Central Indian Population. J Clin Diagn Res. 2014; 8(3): 88-91.

10. Cho SM, Kim J, Ryu HJ, Kim JJ, Kim HH, Park JH, Kim HT, Kim KH, Cho HY, Oh B, Park C, Kimm K, Jo I, Lee JE, Shin HD, Lee JK. Identification of single nucleotide polymorphisms in the tumor necrosis factor (TNF) and TNF receptor superfamily in the Korean population. Hum Immunol. 2004; 65: 710-8.

11. Katherine LO, Flynn O, Brien BA, Alex C. Varghese, Ph.D., Agarwal A., Ph.D. The genetic causes of male factor infertility: A

review by American Society for Reproductive Medicine. 2010; 93(1): 1–12.

12. Sprague AH, Khalil RA. Inflammatory cytokines in vascular dysfunction and vascular disease. 2009; 78(6): 539-52.

13. Kumar A, Abbas W, Herbein G. TNF and TNF receptor superfamily members in HIV infection: new cellular targets for therapy? Mediators Inflamm. 2013; 484378.

14. Wertz IE, Dixit VM. Ubiquitin-mediated regulation of TNFR1 signaling. Cytokine Growth Factor Rev. 2008; 19(3-4): 313-24.

15. Lysiak JJ. The role of tumor necrosis factor-alpha and interleukin-1 in the mammalian testis and their involvement in testicular torsion and autoimmune orchitis. Reprod Biol Endocrinol. 2004; 2:9.

16. Eggert-Kruse W, Kiefer I, Beck C, Demirakca T, et al. Role for tumor necrosis factor alpha (TNF-alpha) and interleukin 1-beta (IL-1beta) determination in seminal plasma during infertility investigation. Fertil Steril. 2007; 87: 810-23.

17. Lazaros LA, Xita NV, Chatzikyriakidou AL, Kaponis AI, et al. Association of TNFα, TNFR1, and TNFR2 polymorphisms with sperm concentration and motility. J Androl. 2012; 33: 74-80.

18. Kosova G, Scott NM, Niederberger C, Prins GS, et al. Genome-wide association study identifies candidate genes for male fertility traits in humans. Am J Hum Genet. 2012; 90(6): 950-61.

19. Said TM, Agarwal A, Falcone T, Sharma RK, et al. Infliximab may reverse the toxic effects induced by tumor necrosis factor alpha in human spermatozoa: an in vitro model. Fertil Steril. 2005; 83(6): 1665-73.

20. Zalata A, Atwa A, Badawy AEN, Aziz A, et al. Tumor Necrosis Factor-α Gene Polymorphism Relationship to Seminal Variables in Infertile Men. UROLOGY. 2013; 81: 962-966.

21. Shukla KK, Agnihotri S, Gupta A, Mahdi AA, et al. Significant association of TNFα and IL-6 gene with male infertility--an explorative study in Indian populations of Uttar Pradesh. Immunol Lett. 2013;156(1-2): 30-7.

 


22. Tronchon V, Vialard F, El Sirkasi M, Dechaud H, et al. Tumor necrosis factor-alpha -308 polymorphism in infertile men with altered sperm production or motility. Hum Reprod. 2008; 23: 2858-66.