بررسی اثر Chir99021 بر تکثیر سلول‌های بنیادی مزانشیمی جدا شده از مغز استخوان جنین گوسفند

نوع مقاله: علمی - پژوهشی

نویسندگان

1 دانشجوی دکتری فیزیولوژی دام، دانشگاه صنعتی اصفهان، دانشکده کشاورزی، گروه علوم دامی، اصفهان، ایران

2 دانشگاه صنعتی اصفهان، دانشکده کشاورزی، گروه علوم دامی، اصفهان، ایران

3 پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری، پژوهشکده زیست‌فناوری کشاورزی، گروه دام و آبزیان

4 دانشجوی دکتری گروه بیوشیمی بالینی، دانشگاه تربیت مدرس تهران دانشکده علوم پزشکی، تهران، ایران

5 موسسه عالی آموزشی و پژوهشی طب انتقال خون، مرکز تحقیقات سازمان انتقال خون ایران

چکیده

هدف: هدف از مطالعه‌ی حاضر بررسی اثر غلظت‌های متفاوت Chir99021 بر تکثیر آزمایشگاهی سلول‏های بنیادی مزانشیمی مغز استخوان (Bone-Marrow Mesenchymal Stem Cells; BM-MSCs) جنین گوسفند است. مواد و روش‏ها: MSCs از مغز استخوان جنین گوسفند جداسازی و کشت داده شد. پتانسیل تمایز این سلول‏ها به سلول‏های استخوان و چربی، در پاساژ سوم بررسی شد. در این مطالعه، BM-MSCs‌ی جنین گوسفند با غلظت‌های متفاوت 0، 5/0، 1، 5/1، 3، 5 میکرومولار Chir99021 کشت داده شدند. در طول دوره‌ی کشت، سلول‏ها از نظر تعداد کلونی، دوبرابر شدن جمعیت سلولی و زمان دو برابر شدن، زنده‌مانی سلولی مورد بررسی قرار گرفتند، علاوه ‌بر این، بیان ژن بتا-کاتنین مورد ارزیابی قرار گرفت. کشت بدون Chir99021 به‏عنوان گروه شاهد در نظر گرفته شد.  نتایج: یافته‌های ما نشان داد که افزودن غلظت‌های 5/0 و 1 میکرومولار Chir99021 به محیط کشت در مقایسه با دوزهای 5 میکرومولار Chir99021 و گروه شاهد به‌صورت معنی‌داری تکثیر را افزایش داده بودند )05/0 p<). علاوه‌براین، پنج روز بعد از تیمار با این ریز مولکول، نتایج نشان دادکه تیمارهای 5/0 و 1 تعداد کلونی بیشتری در مقایسه با تیمارهای کنترل و 5 میکرومولار Chir99021 تشکیل داده‌اند. بیان بتا-کاتنین در گروه مکمل شده با 1 میکرومولار در مقایسه با گروه‏های دریافت‌کننده‌ی غلظت‌های 5/0 و 5/1 به‏صورت معنی‌داری بالاتر بود )05/0 p<). نتیجه‌گیری: نتایج حاصل از این تحقیق نشان داد، به‏کارگیری غلظت 1 میکرومولارChir99021  سبب افزایش تکثیر آزمایشگاهی BM-MSC‌های جنین گوسفند شده است اما به‏کارگیری غلظت‌های بالای این ترکیب اثرات سمی بر تکثیر این سلول‏ها دارد.  

تازه های تحقیق

-

کلیدواژه‌ها


مقدمه

در طب ترمیمی سلول‏های بنیادی مزانشیمی(Mesenchymal Stem Cells; MSCs) با استناد به توانایی تمایز چند دودمانی و خود تجدیدی، امید به زندگی را افزایش داده­اند (1). در دهه‏های گذشته، MSCs از بندناف، خون بند ناف، مغز استخوان، بافت چربی و سایر بافت‏ها استحصال شده­اند (2). استفاده از MSCs نسبت به سلول‏های بنیادی رویانی (Embryonic Stem Cells; ESCs) مزایایی دارد که این مزایا شامل:  مشکلاتی اخلاقی در پی ندارند به این علت که استخراج ESCs­ها معمولا از اپی­بلاست رویان پیش از لانه­گزینی صورت می­گیرد که در نهایت سبب مرگ رویان می­شود. همچنین سبب تشکیل تراتوما نمی­شوند. MSCs برای نسل‏های متوالی در آزمایشگاه تکثیر می­شوند مورفولوژی و محتوای کروموزومی آن‏ها بدون تغییر باقی می­ماند. MSC­ها برخی از مارکرهای سطحی مانند: CD44، CD90، CD73، CD166، CD25،CD105 را بیان می­نمایند و برخی از مارکرهای سطحی از جمله: CD45، CD34، CD11b، CD79a را بیان نمی­کنند (3 و 4). از ویژگی­های دیگر این سلول‏ها، قابلیت تمایز به سلول‏های استخوان، چربی، تاندون، غضروف و ماهیچه است (5) این سلول‏ها زمانی‏که پیوند می­یابند قادر به تحریک سیستم ایمنی میزبان نمی­باشند زیرا که در سطح خود HLA-II را بیان نمی‏کنند. طب ترمیمی بر مبنای سلول‏های بنیادی نیاز به تعداد فراوانِ سلول زنده دارد. برای رسیدن به این هدف، استراتژی­های متفاوتی دنبال می­شود: سرم گوساله­ی جنینی (Fetal Bovine Serum; FBS) در جهت افزایش تکثیر MSCs استفاده شده است (6). سرم در صورتی می­تواند منبع مفیدی برای تکثیر MSCs باشد که از خود فرد استحصال شود. از طرفی ترکیبات سرم از یک منبع به منبع دیگر متفاوت است و احتمال انتقال برخی آلودگی­های پاتولوژیکی وجود دارد که ممکن است در مطالعات کلینیکی مشکل­ساز شود (7). راهکار دیگر، جهت افزایش تکثیر MSCs در شرایط آزمایشگاهی به‏کارگیری سیتوکین­ها و فاکتورهای رشد است. برای مثال، افزودن فاکتور رشد مشتق از پلاکت(Platelet-derived growth factor; PDGF) محرک افزایش تکثیر MSC­های انسانی با فعال‏سازی مسیر هدایتی (c-Jun N-terminal kinases; JNK) است (8). فاکتور رشد تغییر دهنده-بتا (Transforming growth factor beta 1; TGF-β1) به­سرعت سبب انتقال بتا-کاتنین به هسته، به‏روش وابسته به- Smad3؛ و تحریک تکثیر MSC­های انسانی می­شود (9). فاکتور رشد فیبروبلاستی(Fibroblast growth factor; FGF2) نیز، سبب افزایش تکثیر و گسترش MSC­های انسانی شده است (10 و 11) استفاده از سیتوکین­ها و فاکتورهای ­رشد، دارای مشکلاتی از قبیل نیمه عمر پایین و قیمت بالایی می­باشند که افزودن آن‏ها به محیط کشت MSCs، اگرچه محرک افزایش تکثیر سلولی است ولی به­دلایل ذکر شده سبب صرف هزینه کشت بالا می­شود. ریز مولکول­ها ترکیبات سینتتیکی، با وزن مولکولی کمتر از 900 دالتون هستند که به‏راحتی از غشای سلول عبور می­کنند و به جایگاه عمل داخل سلولی خود می­رسند. این ترکیبات در سلول اغلب آنزیم­ها و گیرنده­ها را فعال یا مهار می­کنند. مزایای به‏کارگیری ریز مولکول‏ها عبارتند از: نخست، اثرات بیولوژیکی ریز مولکول‏ها معمولا سریع، قابل برگشت و وابسته به دوز است، با غلظت­های مناسب ریز مولکول‏ها به تنظیم فعالیت­های سلولی کمک می‏شود. دوم، تنوع ساختاری که با سنتز شیمیایی تامین می‏شود، عملکرد بهینه­ی ریز مولکول‏ها را فراهم می­آورد. سوم، در مقایسه با دستکاری­های ژنتیکی، ریز مولکول‏ها به آسانی در شرایط آزمایشگاهی و درون ­تنی استفاده می­شوند و پیشرفت درمانی را عملی­تر می­کنند (12).

مدل‏های حیوانی بزرگ برای مطالعه­ی آسیب­شناسی انسانی نسبت به مدل‏های حیوانی کوچک مانند موش بهتر هستند زیرا که حیوانات اهلی مانند گوسفند از نظر ایمونولوژیکی و فیزیولوژیکی به انسان شبیه­تر هستند (13). ریزمولکول (6-[[2-[[4-(2,4-Dichlorophenyl)-5-(5-methyl-1H-imidazol-2-yl)-2-pyrimidinyl]amino] ethyl] amino]-3-pyridinecarbonitrile; Chir99021) قوی‏ترین مهارکننده گلیکوژن سینتاز کیناز 3 بتا(Glycogen synthase kinase 3 beta; GSK3-3beta) است. استفاده از ریز مولکول Chir99021 در ESCs خودتجدیدی و تکثیر را به­میزان بالایی افزایش داده است و سبب افزایش برنامه­ریزی مجدد سلول‏های سوماتیک به‏سمت عقب یعنی سلول‏های پیش­ساز شده است )14). تاکنون مطالعات اندکی بر روی نقش این ریز مولکول بر تکثیر و زنده­مانی MSCs، خصوصا در مدل‏های حیوانی بزرگ، مانند گوسفند صورت گرفته است. هدف از این مطالعه بررسی اثر افزودن غلظت­های متفاوت Chir99021 به­عنوان قوی­ترین مهارکننده­ی GSK-3beta بر تکثیر و زنده­مانی MSC­های مستخرج از مغز استخوان جنین گوسفند است.

مواد و روش‏ها

تمام مواد شیمیایی به‏ جز مواردی که اشاره شده است از شرکت سیگما خریداری شد. مطالعه­ی حاضر حاصل کار پژوهشی است که در آزمایشگاه دام و آبزیان، پژوهشکده­ی زیست فناوری کشاورزی، پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری انجام گرفت. جنین­های گوسفند 35 روزه از کشتارگاه راک کرج به آزمایشگاه، در محلول نمکی فسفات با خاصیت بافری (Dulbecco's Phosphate-Buffered Saline; DPBS) حاوی آنتی­بیوتیک­های پنی­سیلین و استرپتومایسین روی یخ انتقال داده شد.

کشت MSC­های جداسازی شده از مغز استخوان جنین گوسفند: مغز استخوان، از استخوان­های ران و درشت­نی پس از اطمینان، از سوراخ بودن دو سر استخوان، با استفاده از محیط(Dulbecco's Modified Eagle Medium/ F-12 Ham; DMEM:F12)  به نسبت 3:1 که با 10 درصد FBS همراه با 100 واحد بین­المللی در میلی­لیتر پنی­سیلین و 100 میکروگرم در میلی­لیتر استرپتومایسین مکمل شده بود استحصال شد پس از عبور مایع آسپیره شده از فیلتر 70 میکرومتری، سلول‏های تک هسته­ایی با گرادیانت فایکول (در rpm 4000، به‏مدت 30 دقیقه و درجه حرارت 4 درجه سانتی‏گراد) جداسازی شدند. بعد از جداسازی لایه­ی ابری، دو مرتبه شستشو در DPBS (rpm 3000 برای مدت 10 دقیقه و درجه حرارت 4 درجه سانتی­گراد) انجام گرفت و سپس این سلول‏ها در محیط DMEM:F12 با نسبت 3:1 مکمل شده با FBS، ال-گلوتامین، آنتی بیوتیک­های پنی­سیلین و استرپتومایسین، در فلاسک‏های 25T کشت داده شدند. سپس فلاسک­ها در انکوباتور 37 درجه سانتی­گراد، با شرایط 5 درصد دی­اکسیدکربن و هوای اتمسفری مرطوب قرار گرفتند. MSCs که به کف فلاسک چسبیده بودند مورفولوژی شبیه به سلول‏های فیبروبلاستی از خود نشان می­دهند. بعد از گذشت 48 ساعت محیط رویی این سلول‏ها تعویض شد و پس از رسیدن به تراکم سلولی 80 درصد (5-4 روز بعد از کشت اولیه) با تریپسین 25/0 درصد همراه با یک میلی مولارEDTA) (Ethylenediaminetetraacetic acid; ازکف فلاسک جداسازی شدند و در فلاسک 75T کشت شدند به این مرحله از کشت، پاساژ اول گفته می­شود. تیمارها در پاساژ سوم اعمال شد.

تمایز MSCs به چربی و استخوان: یکی از راه‏های تایید بنیادی بودن سلول‏های جداسازی شده از مغز استخوان، بررسی پتانسیل تمایزی آن‏ها به رده­های مزودرمی، مانند: استخوان و چربی است. برای بررسی تمایز به چربی، MSC­های پاساژ سوم در دانسیته­ی سلولی 104 سلول در پلیت­های چهار چاهکی کشت شدند و زمانی‏که به تراکم سلولی 70 تا 80 درصد رسیدند محیط کشت با محیط تمایز به چربی که از محیط DMEM مکمل شده با FBS، 50 میکروگرم در میلی­لیتر آسکوربیک اسید-2 فسفات، 100 نانومولار دگزامتازون و 50 میکروگرم در میلی­لیتر ایندومتایسین تشکیل شده بود تعویض شد. کشت در محیط تمایز به چربی برای مدت 21 روز ادامه یافت و محیط سلول‏ها، 3 روز یک‏بار عوض شد بعد از اتمام دوره­ی تمایز، سلول‏ها با پارافرم­آلدئید 4 درصد فیکس شدند و سپس با رنگ اویل رد 3 درصد برای مدت 10 تا 15 دقیقه انکوباسیون صورت گرفت و در نهایت بعد از شستشو با DPBS قطرات چربی در زیر میکروسکوپ مشاهده و عکس‏برداری انجام شد.

برای بررسی تمایز به استخوان، MSC­های پاساژ سوم در دانسیته­ی سلولی 104 سلول در پلیت های چهار چاهکی کشت شدند و پس از رسیدن به تراکم سلولی 70 تا 80 درصد محیط کشت، با محیط تمایز به استخوان تعویض شد این محیط شامل: DMEM  مکمل شده با FBS، 50 میکروگرم در میلی­لیتر آسکوربیک اسید-2 فسفات، 10 نانو مولار دگزامتازون و 10 میلی­مولار بتا-گلیسرول فسفات بود. سلول‏ها در محیط تمایزی استخوان برای مدت 21 روز کشت شدند که این محیط هر 3 روز یک‏بار تعویض ­شد. در انتهای دوره­ی کشت سلول‏ها با پارافرم­آلدئید 4 درصد فیکس شدند و رنگ آلیزارین رد 2 درصد برای مدت 5 دقیقه به سلول‏ها اضافه شد بعد از دو مرتبه شستشو با DPBS ماتریکس مینراله شده در زیر میکروسکوپ مشاهده شد و عکس‏برداری انجام گرفت.

بررسی میزان زنده­مانی MSC­های جداسازی شده از مغز استخوان جنین گوسفند تیمار شده با Chir99021 با روش  (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide; MTT)

جهت ارزیابی MTT در ابتدا لازم است که یک منحنی استاندارد رسم شود. برای رسم منحنی استاندارد (با رسم منحنی استاندارد، معادله­ی به‏دست می­آید که تعداد سلول‏های زنده را در گروه‏های تیماری می­توان محاسبه کرد) در یک پلیت 96 چاهکی سلول‏های پاساژ سوم شمارش و کشت شدند لازم است که MSCs در دانسیته­ی سلولی 10000، 20000، 30000، 40000، و 50000، هر کدام در سه تکرار کشت شوند و در همان روز در پلیت 96 چاهکی، برای ارزیابی تاثیر دوزهای متفاوت Chir99021 بر تکثیر و زنده­مانی MSCs، (برای هر دوز سه تکرار)، در هر چاهک 10000 MSC برای مدت 24 ساعت کشت شدند و در روز بعد محیط رویی سلول‏های کشت شده در پلیت مربوط به منحنی استاندارد و گروه‏های تیماری دور ریخته شد و با DPBS شسته شدند و سپس به هر چاهک 100 میکرولیتر محلول MTT زرد (5 میلی­گرم MTT حل شده در یک میلی­لیتر DPBS) اضافه گردید و برای دوره­ی 4 ساعته در انکوباتور، انکوبه شدند. بعد از اتمام دوره­ی انکوباسیون و مشاهده­ی کریستال‏های فورمازان بنفش رنگ با میکروسکوپ، محلول MTT به ­آرامی خارج شد و سپس به چاهک 100 میکرولیتر محلول DMSO اضافه شد و خوب پیپتاژ گشت. از محلول DMSO به‏عنوان Blank استفاده شد و در نهایت در دستگاه الایزا ریدر با نسبت طول موجی 540 تا 630 خوانش انجام گرفت.

ﺳﻨﺠﺶ واﺣﺪ ﻛﻠﻮﻧﻲ ﻓﻴﺒﺮوﺑﻼﺳﺘﻲ (Colony Forming :Unit-Fibroblast; CFU-F)  جهت بررسی تحریک تشکیل CFU-F مغز استخوان، MSC­های پاساژ سوم با دوزهای متفاوت Chir99021 تیمار شدند. بعد از اتمام دوره­ی 5 روزه، محیط رویی سلول‏ها برداشته شد. سلول‏ها دو مرتبه با DPBS شسته شدند و سپس با فرمالین 10 درصد به‏مدت 5 دقیقه سلول‏ها فیکس شدند بعد از اتمام دوره­ی فیکساسیون، فرمالین حذف شد و سلول‏ها با DPBS شستشو شدند و سپس سلول‏ها با رنگ کریستال ویولت 05/0 درصد برای مدت 30 دقیقه انکوبه شدند در اتمام دوره انکوباسیون با رنگ، سلول‏ها چندین مرتبه با آب مقطر استریل شسته شدند و مایع رویی حذف شد. پس از خشک شدن پلیت­ها، عکس برداری و شمارش کلونی­ها با استفاده از میکروسکوپ فاز معکوس انجام گرفت.

زمان دو برابر شدن MSC­های تیمار شده با دوزهای مناسب Chir99021: برای بررسی اثر Chir99021 بر توان تکثیر MSCs، سلول‏های پاساژ سوم با دانسیته­ی 5000 سلول در پلیت­های 6 سانتی­متری مکمل شده با دوزهای صفر، 5/0، 1 و 5/1 میکرومولارChir99021  برای مدت 5 روز کشت داده

 

 شدند. بعد از اتمام دوره­ی کشت سلول‏ها تریپسینه شدند و با استفاده از لام نئوبار شمارش سلولی انجام گرفت.

DT (Doubling Time) = Culture Duration / Population Doubling Number

به منظور محاسبه­ی PDN، رابطه­ی PDN (Population Doubling Number) = log N/N0 * 3.31  به‏کار گرفته شد. در این رابطه N وN0 به‏ترتیب تعداد سلول‏های انتها و آغاز دوره‏ی کشت بودند.

استخراج RNA و Real-time qRT-PCR: استخراج RNA با معرف AccuZol (Bioneer) از MSC­های مغز استخوان جنین گوسفند القا شده و القا نشده انجام گرفت. سپس RNA استخراج شده با DNAase (به‏منظور حذف آلودگی با DNA ژنومی) تیمار شد. سنتز cDNA با کیت سنتزcDNA  (Fermentas) بر طبق دستورالعمل کارخانه انجام گرفت. بیان ژن بتا-کاتنین در مسیر فعال (wingless-type; Wnt) با تکنیک Real-time qRT-PCR و با استفاده از کیت Real time  (Fermentas) مورد ارزیابی قرار گرفت. سطح نسخه‏برداری برطبق سطح بیان ژن خانه­دار GAPDH استاندارد شد. پرایمرهای forward و reverse برای Real-timeqRT-PCR  با نرم­افزار Oligo6 طراحی شدند (جدول 1). پروفیل­های دمایی برایReal-time qRT-PCR  عبارت بود از: دناتوراسیون اولیه در 95 درجه­سانتی­گراد به­مدت 10 دقیقه، 40 سیکل شامل 20 ثانیه دناتوراسیون در 95 درجه­سانتی گراد، سپس 30 ثانیه دمای گداخت 2/58 درجه سانتی­گراد و به‏دنبال آن 20 ثانیه طویل­سازی در 72 درجه­سانتی­گراد، بود. همه­ی واکنش­ها در سه تکرار انجام گرفت و نتایج با روش CTΔΔ-2 آنالیز شد.

 

جدول 1: پرایمرهای Forward و Reverse طراحی شده همراه با طول محصول PCR و دمای گداخت.

نام پرایمر

توالی­ها

دمای گداخت Cº

طول محصول PCR

بتا-کاتنین

For: CAAGGCTACTGTTGGGTTGATTCG

Rev: GACGCTGGGTATCCTGATGTGC

2/58

128

GAPDH یا ژن خانه دار

For: ATCGTGGAGGGACTTATGACC

Rev: CGCCAGTAGAAGCAGGGATG

2/58

130

 

 

 

 

 

 

 

آنالیز آماری

داده‏های به‏دست آمده به‏وسیله­ی نرم افزار SPSS با به‏کارگیری تست ANOVA آنالیز شدند و مقایسه میانگین به‏روش دانکن

 

 

انجام گرفت. داده­ها برمبنای میانگین±انحراف استاندارد نشان داده شدند. سطح معنی‏داری در 05/0p< بررسی گشت.

نتایج

بعد از 24 ساعت از کشت اولیه، MSC­های جداسازی شده از مغز استخوان جنین گوسفند، به‏صورت جمعیت­های کوچک تک سلولی به کف فلاسک می­چسبند. سلول‏هایی که به کف فلاسک نچسبیده بودند در پایان 48 ساعت انکوباسیون با تعویض محیط حذف شدند. اکثر سلول‏ها کلونی­های شبه فیبروبلاستی در زیر میکروسکوپ از خود نشان می­دهند (شکل 1).

 

 

 

شکل 1: MSC­های مغز استخوان جنین گوسفند پاساژ دوم (بزرگ‏نمایی 200×).

 

 

رنگ ­آمیزی آلیزارین رد برای MSC­هایی که در معرض محیط تمایزی استخوان برای مدت 21 روز قرار گرفته بودند وجود رسوبات کلسیم را نشان داد (شکل 2: A و  B)، همچنان‏که

 

 

رنگ‏آمیزی اویل رد، MSC­هایی که در معرض محیط تمایز به چربی برای دوره­ی 21 روزه قرار گرفته بودند واکوئل­های چربی قابل رویت بود (شکل2: C و  D).

 

 

 

شکل 2: A: سلول‏های نرمال رنگ آمیزی شده با آلیزارین رد، B: تمایز به استخوان MSCs بعد از 21 روز، C: سلول‏های نرمال رنگ­آمیزی شدن با اویل رد، D: تمایز به چربی MSCs بعد از 21 روز (بزرگ‏نمایی 200×).

 

 

بررسی میزان تکثیر MSC­های مواجه شده با دوزهای متفاوت

 

Chir99021 به‏روش MTT، میزان تکثیر MSC­های گروه­های تیمار شده با 5/0، 1 میکرومولار Chir99021، در مقایسه با گروه­های 5 میکرومولار Chir99021 و شاهد افزایش معنی­داری داشتند )05/0 p<). از طرفی، حضور دوزهای 5/1 و 3 میکرومولار Chir99021 بر میزان تکثیر، با دوزهای 5/0 و 1 میکرومولار اختلاف معنی­داری نشان ندادند. هر چند که، از نظر عددی میزان تکثیر کمتری ارائه دادند (نمودار 1).

 

 

نمودار 1: مقایسه تعداد MSCs زنده در کشت تداخلی، تیمار شده با دوزهای متفاوت Chir99021

 

 

ارزیابی تاثیر دوزهای متفاوت Chir99021 بر میزان تشکیل CFU-F، MSC­های پاساژ سوم مشخص کرد که افزودن دوزهای 5/0 و 1 به محیط کشت سبب افزایش معنی‏داری در میزان تشکیل CFU-F در مقایسه با گروه­های شاهد و دوز 5

 

 

 

میکرومولار شده بود )05/0 p<). این در حالی است که دوزهای 5/1 و 3 از نظر عددی پایین­تر بودند اما از نظر آماری معنی­دار نبودند (شکل 3، نمودار 2) دوز 5 میکرومولار از نظر آماری کمتر از شاهد بود )05/0 p<).

 

 

 

 

 

شکل 3: اثر دوزهای متفاوت Chir99021 بر میزان تشکیل CFU-F (A: بزرگ‏نمایی 100×، B: بزرگ‏نمایی 200×، C: بزرگ‏نمایی 400×.

 

 

نمودار 2: اثر دوزهای متفاوت Chir99021 بر میزان تشکیل CFU-F، MSCs.

 

 

در این مطالعه­، اثر افزودن Chir99021 بر زمان دو برابر شدن جمعیت MSCs مورد بررسی قرار گرفت. برای این منظور MSC

‏‏های پاساژ سوم به‏میزان 5000 سلول در پلیت­های کشت حاوی دوزهای متفاوت Chir99021 برای مدت 120 ساعت کشت داده شدند. در اتمام دوره سلول‏ها تریپسینه شدند و شمارش سلولی انجام گرفت همانطور که مشاهده می­شود زمان دو برابر شدن در

گروه تیماری 1 میکرومولار به‏صورت معنی‏داری نسبت به گروه‏های شاهد، 5/0و 1.5 کمتر بود (نمودار 3، 05/0 p<).

 

 

 

نمودار 3: اثر دوزهای متفاوت Chir99021 بر زمان دو برابر شدن .MSCs

 

 

همچنین بیشترین PDN مربوط به دوز 1 میکرومولار بود و

نسبت به بقیه گروه‏های تیماری اختلاف معنی‏دار نشان داد (نمودار4).

 

 

 

 

نمودار 4: اثر دوزهای متفاوت Chir99021 بر PDN، .MSCs

 

 

بررسی بیان ژن بتا-کاتنین با استفاده از تکنیک Real-time qRT-PCR، (ژنی که در مسیر هدایتی Wnt فعال، فعال است و

با مهار GSK-3 beta در پی افزودن Chir99021، این ژن و مسیر هدایتی Wnt فعال می­شوند) نشان داد (نمودار 5) که سطح بیان ژن بتا-کاتنین در تیماری که دوز 1 میکرومولار

 

 

 

Chir99021 دریافت کرده بود افزایش یافته بود که در مقایسه با گروه­های شاهد، 5/0 و 5/1 میکرومولار اختلاف معنی­داری نشان می­دهد )05/0 p<).

 

 

 

 

 

 

 

 

 

 

 

 

 

نمودار 5: آنالیز Real-time qRT-PCR، برای بررسی بیان ژن بتا-کاتنین در مسیر هدایتی Wnt در MSC­های تیمار شده با دوزهای متفاوت .Chir99021

 

بحث

MSCs از بافت مغز استخوان جنین گوسفند استحصال شدند و در شرایط آزمایشگاهی در راستای اثبات بنیادی بودن این سلول‏ها، به سلول‏های چربی و استخوان تمایز داده شدند. این سلول‏ها در سلول درمانی و برای آزمایش‏های پیش کلینیکی و کلینیکی مورد استفاده قرار می­گیرند. میزان این سلول‏ها در مغز استخوان بسیار اندک است و تنها حدود 001/0 و 01/0 درصدِ سلول‏های هسته­دار جداسازی شده با فایکول را شامل می­شوند. میزان تکثیر MSCs با افزایش پاساژ کاهش پیدا می­کند. از پاساژ ششم، به­تدریج میزان تکثیر MSCs کاهش می­یابد (15). خود MSCs تحت تاثیر اثرات پیری و بیماری قرار می­گیرند و ممکن است که تکثیر، تمایز، توانایی پیوند و اثرات سرکوب­کنندگی ایمنی در آن‏ها کاهش پیدا کند (16 و17). در سلول درمانی ممکن است به تعداد بالایی سلول نیاز باشد با توجه به نرخ خیلی پایین بقا و زنده­مانی سلول‏ها، ممکن است برای حصول حداکثر نتایج مثبت پیش کلینیکی و کلینیکی به تعداد بالای سلول نیاز باشد (18).

در این مطالعه، اثر افزودن دوزهای متفاوت Chir99021 به عنوان قوی­ترین مهار کننده­ی GSK-3 beta، برروی میزان تکثیر و زنده­مانی MSCs، قابلیت تشکیل CFU-F، PDN و میزان بیان ژن بتاکاتنین در مسیر فعال Wnt مورد بررسی قرار گرفت. در ارزیابی MTT، دوزهای 5/0 و 1 میکرومولار Chir99021 بیشترین میزان تکثیر و زنده­مانی را از خود نشان دادند. افزودن دوزهای متفاوت ریزمولکول Chir99021 بر میزان

 

 

 

تشکیل CFU-F نشان داد که دوزهای 5/0 و 1 میکرومولار سبب تشکیل بیشترین میزان CFU-F در مقایسه با سایر گروه‏ها شده­اند. افزودن دوز 1 میکرومولار Chir99021 سبب کاهش زمان دو برابر شدن و افزایش تکثیر در مقایسه با سایر دوزها شده است. مقایسه بیان کمی ژن بتا-کاتنین در سه دوز Chir99021 یعنی 5/0 ، 1 و 5/1 میکرومولار با گروه شاهد نشان داد که میزان بیان ژن بتا-کاتنین در تیمار 1 میکرومولار با سایر گروه‏ها اختلاف معنی­دار دارد. دوزهای 3 و 5 میکرومولار Chir99021 به‏دلیل سمیتی که در تمایز چربی و استخوان نشان دادند، نقش آن‏ها بر بیان ژن بتا-کاتنین، PDN و DT مورد بررسی قرار نگرفت (اطلاعات ارائه نشده است). پروتئین فعال GSK-3 beta، از فعالیت چرخه­ی Wnt جلوگیری می­کند، تصور می­شود که این چرخه، در حالت فعال، در حفظ پلوری­پوتنتی دخالت دارد. آنزیم GSK-3 beta سطح و فعالیت تعدادی از پروتئین­ها را تنظیم می­کند و یکی از اهداف این آنزیم، مولکول بتا-کاتنین است، در واقع بتا-کاتنین کوفاکتور نسخه­برداری برای ژن‏های هدف چرخه­ی هدایتیWnt است (19). ژن‏های وابسته به Wnt در تنظیم تکثیر شامل: e2f1, c-myc, cyclinD1 ، تمایز شامل: (مارکرهای مزودرمیT/ Brachury, Pitx2) و انتقال از اپی‏تلیال به مزودرم(Epithelial–mesenchymal transition)    شامل:(Slug, Snail, vimentin)  هستند و در طول نمو و در بافت‏های بالغ عمل می­کنند (20، 21، 22 و 23). مهار GSK-3 beta سبب پلوری­پوتنتی و برنامه­ریزی مجدد سلول‏های سوماتیک در جهت ایجاد سلول‏های شبه ESCs یا سلول‏های بنیادی القایی (Induced Pluripotent Stem Cells; IPSCs) می­شود. مهارکننده­های GSK-3 beta سبب ارتقای اشتقاق رده­های ESCs موشی شده­اند (24).

در مطالعه­ی اسلامی نژاد و همکاران (25) زمانی‏که غلظت­های متفاوت BIO (به‏عنوان مهارکننده­ی دیگری از GSK-3 beta) به محیط کشت MSC­های مغز استخوان موش صحرایی اضافه شدند بیشترین میزان تشکیل کلونی­ها زمانی که غلظت­های 1/0 و 1 میکرومولار BIO اضافه شده بود به­دست آمد همچنین کمترین زمان لازم برای دوبرابر شدن نیز در همین دو دوز دیده شده بود. علاوه ­بر این، در آن مطالعه BIO میزان گسترش و زنده مانی MSCs را در شرایط آزمایشگاهی بهبود بخشیده بود. در مطالعه­ی دیگر، اسلامی­نژاد و همکاران (26)، حضور دوزهای متفاوت BIO بر زندمانی MSC­های مغز استخوان موش، نشان داد که دوزهای 05/0 و 1/0 بیشترین تاثیر معنی­دار را بر تکثیر و زنده­مانی MSCs دارند. افزودن دوز 1/0 میکرومولار BIO به محیط کشت MSCهای مستخرج از مغز استخوان موش به‏صورت معنی­داری نرخ رشد بالاتری برمبنای PDN در مقایسه با سایر غلظت‏ها و شاهد ایجاد کرده بود. این محققین این‏گونه نتیجه­گیری کرده­اند که با توجه به مطالعه­ی قبلی­شان بر روی موش صحرایی با دوزهای مشابه BIO این احتمال وجود دارد که پاسخ متفاوت MSC­های موش و موش صحرایی، بدلیل تفاوت گونه­ایی باشد. تفاوت در رفتار تکثیری در MSCهای گونه­های متفاوت گزارش شده است. برای مثال، MSC­های موش در مقایسه با MSC­های انسان و موش صحرایی دیرتر تکثیر و گسترش پیدا می­کنند (27). حتی MSC­های سویه­های متفاوت موش inbred نرخ‏های متفاوتی از تکثیر و تمایز را نشان می­دهند (28). در مطالعه­ی ما که از MSC­های مغز استخوان جنین گوسفند استفاده شد. علاوه بر، نوع سلول، نوع ریز مولکول استفاده شده­ی ما با مطالعات اسلامی­نژاد و همکاران (25) که بر روی MSC­های مغز استخوان گونه­های موش و موش صحرایی کار نمودند تفاوت داشت ما از Chir99021 به‏عنوان قوی­ترین مهارکننده­ی GSK-3 beta استفاده نمودیم. علاوه بر پاسخ‏های گونه­یی، ممکن است ریز مولکول‏های متفاوت نیز پاسخ­های متفاوتی در دوزهای مختلف ایجاد کنند. زنده­مانی دو رده­ی ESCs، یعنی ES-D3 و ES-CCE، با افزودن مهارکننده­های متفاوت GSK-3beta، یعنی: BIO، SB-216763، Chir99021 و Chir-98014 به محیط کشت، در دوزهای متفاوت و غلظت پایین سرم توسط ناجاک و همکاران (29) بررسی شد، آن‏ها سمیت و زنده ­مانی را با تست MTT بررسی کردند، BIO در دوزهای 1/0 تا 1 و بقیه ترکیبات در دوزهای 1 تا 10 میکرومولار اضافه شدند. اثرات سمی مهارکننده­های GSK-3beta برای همه­ی ترکیبات مشاهده شده بود. در رده­ی سلولی ES-D3 زنده­ مانی با افزودن دوزهای بالاتر از 1/0 BIO کاهش یافته بود. در گروه‏های که با SB-216763 و Chir99021 تیمار شده بودند نیز دوزهای بالاتر از 1 میکرومولار سبب کاهش تعداد سلول‏های زنده شده بود. در همین سویه تمامی دوزهای Chir-98014 سبب کاهش تکثیر و زنده­مانی شده بودند. همه­ی دوزهای مهار کننده­های مختلف استفاده شده در مورد سویه­ی ES-CCE سمیت نشان دادند. در آن مطالعه افزودن SB-216763 و Chir99021 کمترین سمیت را بر زنده­مانی هر دو لاین نشان داده بودند (29). در مطالعه­ی  حاضر نیز برخلاف مطالعه­ی ناجاک و همکاران، زمانی‏که دوزهای 5/0 و 1 میکرو مولار استفاده شده بود بیشترین میزان زنده­مانی مشاهده شد. این درحالی‏که است که تنها زمانی‏که دوز 5 میکرومولار استفاده شد روند کاهشی تکثیر مشابه با شاهد بود به‏نظر می­رسد که دوزهای بالاتر از 5 میکرومولار ممکن است سبب کاهش میزان زنده­مانی و تکثیر MSC­های مستخرج از مغز استخوان جنین گوسفند شوند. همان‏طور که در بالا ذکر شد در مطالعه­ی ناجاک و همکاران در سویه­ی ES-D3 دوزهای بالاتر از 1 میکرومولار Chir99021 سمیت نشان داده بود و در سویه­ی ES-CCE تمامی دوزهای استفاده شده حتی دوز 1 میکرومولار سبب کاهش تکثیر و زنده­مانی شده بودند. البته باید به این نکته اشاره شود که در مقایسه با مطالعه­ی ناجاک و همکاران، گذشته از گونه حیوانی متفاوت، آنها از ESCs و ما از MSCs استفاده نمودیم ممکن است پاسخ سلول‏های بنیادی متفاوت به ریز مولکول‏های یکسان در شرایط آزمایشگاهی متفاوت باشد. در مطالعه­ی چن و همکاران (30)، افزودن ریز مولکول BIO، به محیط کشت فیبروبلاست‏های رویانی موش، سبب افزایش تکثیر شده بود. در آن مطالعه ارتباط چرخه­ی بتا-کاتنین و چرخه­ی سیگنال دهنده Notch و تاثیر این دو بر تکثیر آن سلول‏ها به اثبات رسیده است. همان‏طور که اشاره شد استفاده از BIO به‏عنوان مهار کننده­ی  GSK-3 betaدر نهایت منجر به افزایش سیتوپلاسمی و ورود بتا-کاتنین به‏داخل هسته سلول می‏شود و بتا-کاتنین سبب بیان شدن یک سری از ژن‏های پلوری پوتنتی از قبیل Nanog، Oct4، Sox2 و Jag1 می­شود. ترکیب اخیر یعنی Jag1 به‏عنوان لیگاندی برای نواحی خارج سلولیNotch  عمل می­کند و اتصال این لیگاند سبب شکسته شدن نواحی داخل سلولی NICD به‏وسیله­ی آنزیم گاما­سکرتاز می­‏شود. حال اگر مهار­کننده­ی گاما سکرتاز به محیط اضافه شود. نواحی داخل سلولی شکسته نشده و حضور این نواحی سبب تجزیه­ی بیشتر بتاکاتنین می­‏شود. پس عدم فعالیت NICD و فعالیت GSK-3 beta سبب کاهش میزان بتا-کاتنین در سلول می­شود در آن مطالعه زمانی‏که سلول‏های فیبروبلاستی موشی با 5 میکرومولار BIO  تیمار شدند سبب افزایش 98 برابری میزان بتا-کاتنین شد در حالی‏که حضور مهار کننده­ی گاما سکرتاز وBIO  سبب کاهش میزان ورود بتا-کاتنین به هسته سلول شده بود و افزایش تکثیر در نتیجه­ی اثر متقابل این دو چرخه است. در مطالعه­یی دیگر بر روی ESC­های مشتق از موش­های سویه­ی سرسخت مهار GSK-3 beta به‏وسیله­یChir99021  خودتجدیدی را ارتقا داده است (31). مهار کننده­ی Chir99021 الگوی بیان ژن‏های کد کننده­ی پروتئین به‏ویژه فاکتورهای نسخه­برداری، ژن‏های تنظیمی اپی­ژنتیکی و‏RNA های غیر کد کننده در ESC­های موشی در جهت ایجاد شبکه پلوری­پوتنتی نسبتا ثابت، تغییر می­دهد (14). مهار کننده­ی BIO در مقایسه با مهار کننده­یChir99021  برای GSK-3 beta کمتر انتخابی است و احتمالا کیناز­های متفاوت دیگری شامل کینازهای وابسته به سیکلین (Cyclin-dependent kinases; Cdks)، گیرنده­ی FGF  و کینازهای تنظیم­کننده­ی سیگنال خارج سلولی (extracellular signal-regulated kinases; Erk)  را نیز مهار می کند (32).

در سلول درمانی به‏میزان بالایی سلول زنده نیاز است استفاده از محیط‏های تعریف شده عاری از سرم می­تواند خطر انتقال مواد بیولوژیک را در مقایسه با محیط‏های تعریف نشده، حاوی سرم، کاهش دهد یکی از راه‏کارهای افزایش تکثیر استفاده از ریز مولکول‏های تاثیرگذار بر مسیرهای تکثیر سلولی است Chir99021 به‏عنوان قوی­ترین مهارکننده­ی GSK-3 beta می­تواند علاوه بر مهار GSK-3beta در داخل سلول، سبب فعال شدن مسیر هدایتی Wnt شود و سپس ورود بتا-کاتنین به داخل هسته­ی سلول و فعال شدن کمپلکس نسخه­برداری TCF-LEF شود با فعال سازی این کمپلکس نسخه­برداری، از ژن‏های مرتبط با تکثیر از جمله c-Myc و cyclin D1 نسخه­برداری صورت می­گیرد.

نتیجه گیری

با توجه به نتایج به‏دست آمده در این مطالعه­، به نظر می­رسد که استفاده از دوزهای 1 و 5/0 میکرومولار Chir99021 بیشترین تاثیر را بر تکثیر و زندمانی و تشکیل CFU-F، MSC­های مستخرج از جنین گوسفند دارند. از طرفی دوز 1 میکرومولار Chir99021 بیشترین تاثیر را بر دو برابر شدن جمعیت سلولی، کاهش زمان دو برابر شدن و بیان ژن بتا-کاتنین، در MSC­های مستخرج از جنین گوسفند دارد. پیشنهاد می­شود که تاثیر این ریز مولکول بر بیان ژن‏ها و پروتئین­های مرتبط با تکثیر سلول‏های بنیادی استخراج شده از منابع مختلف مورد بررسی قرار گیرد.

تشکر و قدردانی

از مهندس جدی رئیس کشتارگاه راک کرج به­خاطر همکاری در جهت تامین و ارسال نمونه­های جنین گوسفند تشکر و قدردانی می­شود.

  1. Zou JP, Huang S, Peng Y, Liu HW, et al. Mesenchymal stem cells/multipotent mesenchymal stromal cells (MSCs): potential role in healing cutaneous chronic wounds. The international journal of lower extremity wounds. 2012; 11(4): 244-53.
2. da Silva ML, Chagastelles PC, Nardi NB. Mesenchymal stem cells reside in virtually all post-natal organs and tissues. Journal of Cell Science. 2006; 119: 2204-13.

3.  Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, et al. Multilineage potential of adult human mesenchymal stem cells. Science. 1999; 284: 143–147.

4. Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, et al. Minimal criteria for de fi ning multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy. 2006; 8(4): 315–317.

5. Minguell JJ, Erices A. Mesenchymal stem cells and the treatment of cardiac disease. Experimental Biology and Medicine. 2006; 231(1): 39–49.

6.  Phinny DG, Kopen G, Righter W, Webster S, et al. Donor variation in the growth properties and osteogenic potential of human marrow stromal cells. Journal of Cellular Biochemistry. 1999; 75(3): 424-436.

7.  Karamishabankareh H, Kafilzadeh F, Soltani L. Treatment of ovine oocytes with certain water- soluble vitamins during in vitro maturation (IVM). Small Ruminant Research. 2012; 104: 139-145.

8. Kang YJ, Jeon ES, Song HY, Woo JS, et al. Role of c-Jun N-terminal kinase in the PDGF-induced proliferation and migration of human adipose tissue-derived mesenchymal stem cells. Journal of Cellular

 

 

Biochemistry. 2005; 95(6): 1135–1145.

9. Jian H, Shen X, Liu I, Semenov M, et al. Smad3-dependent nuclear translocation ofb-catenin is required for TGF-b1-induced proliferation of bone marrow-derived adult human mesenchymal stem cells. Genes & Development. 2006; 20(16) 666–674.

10. Solchaga LA, Penick K, Porter JD, Goldberg VM, et al. FGF-2 enhances the mitotic and chondrogenic potentials of human adult bone marrow-derived mesenchymal stem cells. Journal of Cellular Physiology. 2005; 203(2): 398–409.

11. Tsutsumi S, Shimazu A, Miyazaki K, Pan H, et al. Retention of multilineage differentiation potential of mesenchymal cells during proliferation in response to FGF. Biochemical and Biophysical Research Communications. 2001; 288(2): 413–419.

12. Zhang Y, Li W, Laurent T, Ding S. Small molecules, big roles – the chemical manipulation of stem cell fate and somatic cell reprogramming. Journal of Cell Science. 2012; 125: 5609–562.

13. De KA, Malakar D, Akshey YS, Jena MK, et al. Isolation and Characterization of Embryonic Stem Cell-Like Cells From in vitro Produced Goat (Capra hircus) Embryos. Animal Biotechnology. 2011; 22(4): 181–196.

14. Wu Y, Ai Z, Yao K, Cao L, et al. Chir99021 promotes self-renewal of mouse embryonic stem cells by modulation of protein-encoding gene and long intergenic non-coding RNA expression. Experimental Cell Research. 2013; 319(17): 2684-99.

15. Xu W, Zhang X, Qian H, Zhu W, et al. Mesenchymal stem cells from adult human bone marrow differentiate into a cardiomyocyte phenotype in vitro. Experimental Biology and Medicine. 2004; 229(7): 623-31.

16. O’Donoghue K, Fisk NM. Fetal stem cells. Best Pract Res Clin Obstet Gynaecol 2004; 18(6): 853–875.

17. Roobrouck VD, Ulloa-Montoya F, Verfaillie CM. Self-renewal and differentiation capacity of young and aged stem cells. Experimental Cell Research. 2008; 314(9): 1937–1944.

18.  Herberts CA, Kwa MSG, Hermsen HPH. Risk factors in the development of stem cell therapy.  Journal of Translational Medicine. 2011; 9(1): 29.

19. Jope RS, Johnson GV. The glamour and gloom of glycogen synthase kinase-3. Trends in Biochemical Sciences. 2004; 29(2): 95–102.

20. Arnold SJ, Stappert J, Bauer A, Kispert A, et al. Brachyury is a target gene of the Wnt/beta-catenin signaling pathway. Mechanisms of Development. 2000; 91(1-2): 249–258.

21.  Wang J, Wynshaw-Boris A. The canonical Wnt pathway in early mammalian embryogenesis and stem cell maintenance/differentiation. Current Opinion in Genetics & Development. 2004; 14(5): 533–539.

22. Willert K, Jones KA. Wnt signaling: is the party in the nucleus? Genes & Development. 2006; 20(11): 1394–1404.

23.  Abramova MV, Pospelova TV, Nikulenkov FP, Hollander CM, et al. G1/S arrest induced by histone deacetylase inhibitor sodium butyrate in E1A + Ras-transformed cells is mediated through down-regulation of E2F activity and stabilization of beta-catenin. The Journal of Biological Chemistry. 2006; 281: 21040–21051.

 

24. Umehara H, Kimura T, Ohtsuka S, Nakamura T, et al. Efficient derivation of embryonic stem cells by inhibition of glycogen synthase kinase-3. Stem Cells. 2007; 25: 2705–2711.

25. Eslaminejad MB, Salami F, Soleimani Mehranjani M, Abnoosi MH, et al. BIO treatment enhances rat marrow-derived mesenchymal stem cell in vitro proliferation and viability. Physiology and Pharmacology. 2009; 13: 57-67.

26. Eslaminejad MB, Salami F, Soleimani Mehranjani M, Abnoosi MH, et al. BIO treatment protects rat marrow-derived mesenchymal stem cell culture against the TNF-α induced apoptosis. Cell Journal (Yakhteh). 2009; 11(1): 35-42.

27. Martin I, Muraglia A, Campanile G, Cancedda R, et al. Fibroblast growth factor-2 supports ex vivo expansion and maintenance of osteogenic precursors from human bone marrow. Endocrinology. 1997; 138(10): 4456-4462.

28.  Peister A, Mellad JA, Larson BL, Hall BM, et al. Adult stem cells from bone marrow (MSCs) isolated from different strains of inbred mice vary in surface epitopes, rates of proliferation, and differentiation potential. Blood. 2004; 103(5); 1662-1668.

29. Naujok O, Lentes J, Diekmann U, Davenport C, et al. Cytotoxicity and activation of the Wnt/beta-catenin pathway in mouse embryonic stem cells treated with four GSK3 inhibitors. BMC Research Notes. 2014; 7:273.

30. Chen C, Hoffman DM, Reynolds D, Benoit SWS. Inhibition of Notch signaling reduces Wnt/β-catenin-mediated mesenchymal stem cell proliferation.

31. Yao, Y, Li W, Wu J, Germann UA, et al. Extracellular signal-regulated kinase 2 is necessary for mesoderm differentiation. Proceedings of the National Academy of Sciences. 2003; 100(22): 12759–12764.

32. Zhen Y, Sorensen V, Jin Y, Suo Z, et al. Indirubin-3-monoxime inhibits autophosphorylation of FGFR1 and stimulates ERK1/2 activity via p38 MAPK. Oncogene. 2007; 26: 6372-6385.