کانال‌های آبی NtPIP1;1 و NtPIP2;1 توزیع مکانی متفاوتی در سلول‌های گیاه توتون دارند

نوع مقاله: علمی - پژوهشی

-

چکیده

هدف: حرکت آب از عرض غشاهای سلولی با حضور پروتئین‌هایی بنام ‌کانال آبی یا آکواپورین تسهیل می‌شود. کانال‌‌های آبی غشاپلاسمایی گیاهان به دو گروه PIP1s و PIP2s تقسیم می‌شوند که فعالیت انتقال آب متفاوتی را نشان می‌دهند به طوری که PIP1s غیرفعال بوده، در حالیکه PIP2s افزایش قابل توجهی را در ضریب نفوذپذیری آبی اسموتیک غشاء (Pf) موجب می‌شود. این تفاوت در فعالیت انتقال آب آن‌ها می‌تواند ناشی از مکان متفاوت آن‌ها در سلول باشد. هدف از این تحقیق بررسی مکان درون سلولی دو کانال آبی NtPIP1;1 (عضو گروه PIP1s) و NtPIP2;1 (عضو گروه PIP2s) در سلول‌های زنده مزوفیل برگ گیاه توتون است. 
مواد و روش‌ها: در این مطالعه تجربی توالی cDNA دو کانال آبی به توالی ژن کد کننده پروتئین فلورسانت سبز (GFP) متصل گردید و به طور موقتی در پروتوپلاست‌های تهیه شده از مزوفیل برگ توتون بیان شدند. سپس با استفاده از طول موج برانگیختگی نور آبی مکان درون سلولی این دو کانال آبی در زیر میکروسکوپ فلورسانس بررسی شد.
نتایج: نتایج نشان داد که NtPIP1;1 در ساختارهای غشایی داخل سلول باقی مانده در حالی‏که NtPIP2;1 به غشا پلاسمایی منتقل می‌شود. بیان همزمان وکتور‌های حامل توالی NtPIP1;1-GFP و HDEL-YFP (نشانگر شبکه اندوپلاسمی متصل به پروتئین با فلورسانس زرد) در پروتوپلاست‌ها نشان داد که NtPIP1;1 در مکان‌هایی مشابه با HDEL (لیزین- آسپارتیک اسید- گلوتامیک اسید-لوسین) در سلول قرار می‌گیرد.
نتیجه گیری: کانال آبی NtPIP2;1 به غشاء پلاسمایی سلول مستقر شده در حالی‏که NtPIP1;1 در داخل شبکه آندوپلاسمی باقی مانده و به غشا پلاسمایی منتقل نمی‌شود و به همین دلیل فاقد فعالیت انتقال آب است.
 
 

کلیدواژه‌ها


مقدمه

حرکت آب از عرض غشاهای سلولی در اثر حضور کانال‌های آبی به نام آکواپورین‌ها (AQPs) تسهیل می‌شود. این پروتئین‌ها مرکب از شش دومین طی کننده‏ی عرض غشا بوده که توسط 5 لوپ به یکدیگر متصل شده‌اند بطوری‏که N و C ترمینال آن‌ها در داخل سیتوسول قرار دارد (1 و 2).

آکواپورین‌های گیاهی تنوع ایزوفرمی قابل توجهی را نشان می‌دهند. تعیین توالی ژنوم، تعداد دقیق ژن‌های آکواپورین را تا مرز 35 عدد در گیاه آرابیدوپسیس (2 و 3) و 33 عدد در گیاه ذرت (1 و4) تعیین نموده است. بر پایه‏ی شباهت توالی، آکواپورین‌های گیاهی به 4 زیر گروه که تا حدودی مطابق با مکان آن‌ها در سلول است تقسیم می‌شوند (1، 2 و 5). پروتئین‌های نوع تونوپلاستی (TIPs) و نوع غشا پلاسمایی (PIPs) آکوارپورین‌هایی هستند که به ترتیب در غشاهای واکوئلی و پلاسمایی به وفور بیان می‌شوند. سومین زیر گروه شامل پروتئین‌های غشایی شبه نودولین26 (NIPs) هستند. به عبارتی این زیر گروه همولوگ‌های نزدیک به GmNod26 (آکواپورین فراوان در غشا پری‌باکتروئید گرهک‌های تثبیت کننده‏ی ازت در ریشه‌های سویا) می‌باشند. NIPs در غیرلگوم‌ها نیز وجود دارند و در این گیاهان در غشاهای پلاسمایی و درون سلولی قرار گرفته‌اند (2). زیر گروه آخر پروتئین‌های بازی کوچک (SIPs) بوده که غالبا در شبکه‏ی آندوپلاسمی قرار دارند (2).

آکواپورین‌های غشا پلاسمایی یا PIPs خود به دو گروه فیلوژنتیکی PIP1 و PIP2 تقسیم می‌شوند. اعضای این دو گروه نه تنها از لحاظ طول N و C ترمینال خود متفاوت می‌باشند بلکه فعالیت کانال آب متفاوتی را هنگام بیان در اووسیت‌های زنوپوس نشان می‌دهند (6). درحالی‏که PIP1s عموما در این میزبان هترولوگ خاموش می‌باشند، PIP2s فعالیت کانال آب بالایی را نشان می‌دهند. مطالعات دقیق‌تر بر روی مکان درون سلولی آکواپورین‌های نوع PIP1 و PIP2 در پروتوپلاست‌های مزوفیل گیاه ذرت نشان می‌دهد که دلیل پائین بودن فعالیت انتقال آب در آکواپورین‌های نوع PIP1 به خاطر باقی ماندن این آکواپورین‌ها در داخل شبکه آندوپلاسمی و در نتیجه عدم انتقال آن‌ها به داخل غشا پلاسمایی سلول‌های گیاهی می‌باشد (7). قبلا ما نشان دادیم که آکواپورین NtPIP1;1 گیاه توتون هنگام بیان در اووسیت‌های زنوپوس، به مقدار زیاد در داخل سیتوپلاسم اووسیت باقی مانده و کمتر به غشا مهاجرت می‌کند (8). برای مطالعه دقیق‌تر این مطلب، در این تحقیق محل درون سلولیNtPIP1;1 وNtPIP2;1 در داخل سلول‌های زنده مزوفیل گیاه توتون با استفاده از مارکرهای غشایی مختلف مورد مطالعه قرار گرفت.

 

مواد و روش‌ها

تهیه گیاه: گیاه توتون (Nicotiana tabacum cv. Samsun) در شرایط آزمایشگاهی در اتاقک رشد در دمای 22 درجه سانتی‌گراد با رژیم نوری 16 ساعت روشنایی 8 ساعت تاریکی با شدت نور 150 میکرومول بر مترمربع بر ثانیه بر روی محیط کشت جامد موراشیک و اسکوگ (MS) (9) با قدرت نصف (8/0درصد آگار) حاوی 1 درصد سوکروز و 5 میلی‌مولار MES- KOH، pH برابر 5/5 به مدت 3 الی 4 هفته به منظور تهیه پروتوپلاست رشد داده شد (8).

اتصال پروتئین فلورسانت سبز (Green Fluorescent Protein, GFP) به C یا N-ترمینال پروتئین آکواپورین: کلیه مراحل مولکولی طبق روش Sambrook و همکاران (10) انجام گرفت. برای اتصال GFP به C-ترمینال آکواپورین‌هایNtPIP1;1 وNtPIP2;1، ابتدا cDNA مربوط به آن‌ها توسط PCR با استفاده از پرایمرهای اختصاصی جهت اتصال سایت‌های با اثر محدود XhoI و SpeI به ترتیب در انتهای َ5 و َ3 آن‌ها تکثیر شدند. توالی پرایمرها در جدول 1 ارائه شده است (8).

محصولات تکثیر برای اطمینان از عدم وجود خطا در توالی پروتئین، در وکتور TOPO کلون و توالی آن‌ها توسط دستگاه توالی‌یابDNA  طبق روش Sanger و همکارن (11) تعیین گردید.

برای اتصال GFP به N-ترمینال آکواپورین‌های فوق، از پرایمرهای اختصاصی جهت اتصال سایت‌های با اثر محدود XbaI و BamHI به ترتیب در انتهای َ5 و َ3 cDNA NtPIP1;1 وNtPIP2;1 استفاده شد. توالی پرایمرها در جدول 2 ارائه شده است.

قرار دادن NtPIP1;1 cDNA و NtPIP2;1 در کاست بیانی GFP-JFH: وکتور به کار رفته برای بیان موقتی در پروتوپلاست‌های مزوفیل تنباکو عبارت بود از pUC19 که حاوی کاست بیانی GFP-JFH-1 می‌باشد. شکل 1 محل آنزیم‌های با اثر محدود جهت کلون سازی در این کاست بیانی را نشان می‌دهد. این کاست دارای پروموتر قوی 35S از ویروس موزائیک گل کم (CaMV 35S) و خاتمه دهنده‏ی رونویسی نوپالین سنتاز (NOS) از آگروباکتریوم می‌باشد (12). برای اتصال GFP به C-ترمینال یا N-ترمینال آکواپورین‌های NtPIP1;1 و NtPIP2;1، ابتدا کلون‌های cDNA NtPIP1;1 یا NtPIP2;1 همراه با وکتور بیانی فوق در معرض هضم آنزیمی مضاعف قرار گرفتند (10).

 

جدول 1: توالی پرایمرهای به کار رفته جهت اتصال سایت‌های XhoI و SpeI به cDNA آکواپورین

ژن

توالی پرایمرهای جلویی (Fw) و معکوس (Rv)

دمای ذوب  ( Cْ)

NtPIP1;1

Fw: 5′ CGCTCGAGATGGCAGAAAACAAAGAAG 3′

                    XhoI

Rv: 5′ CGACTAGTGCTCTTGAATGGAATGGC3′  

                    SpeI                                       

62

1/62

NtPIP2;1

Fw: 5′ CGCTCGAGATGTCAAAGGACGTGATTG 3′

                     XhoI

Rv: 5′ CGACTAGT GTTGGTTGGGTTACTGCG 3′

                    SpeI

5/63

6/63

 

جدول 2: توالی پرایمرهای به کار رفته جهت اتصال سایت‌های XbaI و BamHI به cDNA آکواپورین (8).

ژن

توالی پرایمرهای جلویی (Fw) و معکوس (Rv)

دمای ذوب  ( Cْ)

NtPIP1;1

Fw: 5′ CGTCTAGAATGGCAGAAAACAAAGAAG 3′

                   XbaI

Rv: 5′ CGGGATCCTTAGCTCTTGAATGGAATG 3′

                  BamHI

9/61

 

62

NtPIP2;1

Fw: 5′ CGTCTAGAATGTCAAAGGACGTGATTC 3′

                     XbaI

Rv: 5′ CGGGATCCTTAGTTGGTTGGGTTACTG 3′

                   BamHI

4/63

 

4/63

 

 

 

 

شکل 1: نقشه‏ی کاست بیانی GFP-JFH-I (12).

 

 

بعد از انجام الکتروفورز ژل آگارز 2 درصد، باندهای با اندازه‏ی مورد نظر از ژل بریده و توسط کیت استخراج از ژل (Qiagen)، DNA استخراج گردید. برای انجام واکنش اتصال از نسبت مولی 3 به 1 (insert:vector) و میزان 100 نانوگرم وکتور استفاده شد. میزان insert بر حسب نانوگرم طبق رابطه زیر محاسبه شد:

 

واکنش اتصال با استفاده از کیت Ligation High (شرکت TOYOBO، ژاپن) در طول شب در دمای 16 درجه سانتی‌گراد انجام گرفت. سپس محصول واکنش اتصال به باکتری سوش JIM109 با استفاده از شوک حرارتی منتقل شد و انتخاب باکترهای ترانسفرم شده بر روی پلیت‌های LB حاوی 50 میکروگرم بر میلی‌لیتر آنتی‌بیوتیک آمپی‌سیلین انجام شد (10). بعد از تایید حضور ژن در وکتور توسط کلنی  PCRو هضم آنزیمی، کلنی‌های مثبت در محیط LB مایع تکثیر و پلاسمید نوترکیب توسط کیت Plasmid Miniprep (BioRad) استخراج گردید. از این پلاسمید جهت ترانسفرم کردن پروتوپلاست‌های مزوفیل توتون استفاده شد.

جداسازی پروتوپلاست مزوفیل برگ توتون: جداسازی پروتوپلاست‌های مزوفیل توتون مطابق روش Hosy و همکاران (12) انجام شد. به طور خلاصه برگ‌های توتون به طول 5 سانتی‌متر از گیاهان 4 هفته‌ای رشد یافته در شرایط آزمایشگاهی در محیط MS با قدرت نصف تحت شرایط استریل برداشت شدند و سطح تحتانی آن‌ها با کاغذ سمباده ساییده شدند. سپس برگ‌ها در داخل پتری دیش‌های حاوی 10 میلی‌لیتر محیط هضم استریل EF به مدت 19 ساعت در تاریکی در دمای 25 درجه سانتی‌گراد قرار داده شدند.

بعد از هضم آنزیمی، قطعات هضم شده‏ی برگ‌های دور ریخته شدند و 4 میلی لیتر محیط شناورسازی MLO6 به داخل پتری دیش اضافه شد. سپس سوسپانسیون پروتوپلاست ازخلال فیلتر نایلونی 100 میکرونی فیلتر شد و با سرعت g110 به مدت 7 دقیقه سانتریفیوژ شد. پروتوپلاست‌های قرار گرفته در باند شناور در سطح لوله‌های سانتریفیوژ برداشت شدند و با 4 حجم از محیط شستشوی W5 اتوکلاو شده رقیق شدند. سپس سلول‌ها در سرعت g110 به مدت 7 دقیقه رسوب داده شدند و رسوب در40 میلی‏لیتر و سپس 20 میلی‏لیتر محلول مانیتول/ Mg شستشو داده شد. در پایان، پروتوپلاست‌ها  در محلول فوق در غلظت 6 10 سلول در میلی‏لیتر معلق شدند.

ترانسفرم کردن پروتوپلاست‌ها: در یک لوله اپندروف، 150 میکرولیتر از پروتوپلاست‌های غلیظ شده و 150 میکرولیتر محلول PEG به 5 الی 10 میکروگرم DNA پلاسمیدی مورد نظر اضافه شدند و به مدت 30 دقیقه در دمای اتاق انکوبه شدند. سپس نمونه با 8 میلی‌لیتر از محیط K3M استریل تکمیل شده با 45/0 مولار گلوکز رقیق شده و به مدت 7 دقیقه در سرعت  g110 رسوب داده شدند (12). سرانجام پروتوپلاست‌ها در 3 میلی لیتر محیط K3M استریل معلق شده و به مدت 16 الی 24 ساعت در دمای 20 درجه سانتی‌گراد در تاریکی قبل از آنالیز انکوبه شدند (12). برای بیان توام NtPIP1;1-GFP یا NtPIP1;1 GFP- با YFP:HDEL (مارکر شبکه آندوپلاسمی (13)، هدیه از پروفسور کریس هاوز از دانشگاه بروکس آکسفورد)، 5 میکروگرم از هر یک از پلاسمیدها به طور همزمان با هم به پروتوپلاست‌ها انتقال داده شدند (12).

آنالیز بیان GFP، YFP و FM4-64 در پروتوپلاست‌های ترانسفرم شده توسط میکروسکوپ لیزری فلورسانس: تعیین محل زیر سلولی آکواپورین‌های متصل به GFP، پروتئین HDEL متصل به پروتئین فلورسانت زرد (YFP) و مارکر غشایی FM4-64 (Invitrogen) در پروتوپلاست‌های توتون توسط میکروسکوپlaser scanning Biozero (لنزهای اُبژکتیو 40، Bz-8000،  شرکت KEYENCE، اُزاکا، ژاپن) انجام شد. برای گرفتن فلورسانت GFP، طول موج برانگیختگی 470 نانومتر و طول موج آشکارسازی 535 نانومتر استفاده شدند. برای گرفتن فلورسانت FM4-64 در پروتوپلاست‌هایی که  NtPIP2;1-GFPیا GFP-NtPIP2;1 را بیان می‌کنند، طول موج برانگیختگی 540 نانومتر و طول موج آشکارسازی 605 نانومتر استفاده شدند. برای گرفتن فلورسانت YFP در پروتوپلاست‌هایی که NtPIP1;1-GFP یا GFP-NtPIP1;1 را همراه با YFP:HDEL بیان می‌کنند، از طول موج برانگیختگی 514 نانومتر و طول موج آشکارسازی 539-590 نانومتر استفاده شد. تصاویر با نرم افزارBiozero Analyzer  آنالیز شدند. نشان‎دار کردن غشاء پلاسمایی با FM4-64 از طریق انکوبه کردن پروتوپلاست‌ها بر روی یخ به مدت 10 دقیقه در محیط کشت تکمیل شده با 50 میکرومولار FM4-64 انجام گرفت (12).

 

نتایج

به منظور تعیین توزیع آکواپورین‌های NtPIP1;1 و NtPIP2;1 در یک سلول گیاهی کامل، سازه‏ی ژنی حاوی اتصال قابل ترجمه میان هر یک از آکواپورین‌ها و پروتئین GFP توسط ترانسفرم کردن موقتی به واسطه‏ی PEG به داخل پروتوپلاست‌های مزوفیل برگ‌های توتون منتقل شدند و فلورسانت اختصاصی GFP رویت شد. GFP به C- ترمینال یا N- ترمینال آکواپورین‌های NtPIP1;1 و NtPIP2;1 برای اطمینان از عدم تداخل  GFP با انتقال آکواپورین به غشا پلاسمایی متصل شد. محل زیر سلولی هر پروتئین NtPIP متصل به GFP در پروتوپلاست‌های ترانسفرم شده‏ی توتون با استفاده از میکروسکوپ فلورسانس تعیین شد.

نتایج نشان داد سلول‌هایی که به طور موقتی NtPIP2;1-GFP (GFP متصل به C- ترمینال) یا GFP-NtPIP2;1 (GFP متصل به N-ترمینال) را بیان می‌کنند فلورسانت سبز رنگ شدیدی (شکل2 b و d) را در غشاء پلاسمایی نسبت به کنترل منفی (شکل2 a) نشان می‌دهند که توسط مارکر غشاء پلاسمایی FM4-64 تایید شد (شکل 2 c و e فلورسانت قرمز). این نتیجه نشان می‌دهد که آکواپورین NtPIP2:1 در غشا پلاسمایی قرار می‌گیرد و اتصال GFP به C- ترمینال یا N- ترمینال این پروتئین تاثیری در هدف‌گیری آن به سمت غشا پلاسمایی ندارد.

فلورسانت سبز رنگ حاصل از GFP-NtPIP2;1 یا NtPIP2;1-GFP بعضی مواقع در ساختارهای وزیکولی در مجاورت غشا پلاسمایی مشاهده می‌شوند (شکل 3) که مربوط به پروتئین‌هایی هستند که در مسیر، از محل سنتزشان در داخل شبکه آندوپلاسمی به مکان استقرارشان در غشا پلاسمایی در حال گذر هستند (7).

 

شکل 2: تعیین مکان درون سلولی NtPIP2;1 متصل به پروتئین GFP. (a) پروتوپلاست مزوفیل توتون در حالت زمینه روشن. (b) پروتوپلاست مزوفیل که NtPIP2;1-GFP را بیان می‌کند. (c) نشان دار کردن غشاء پلاسمایی پروتوپلاست مزوفیل در شکل (b) با مارکر اختصاصی غشاء پلاسمایی (FM4-64). (d) پروتوپلاست مزوفیل که GFP-NtPIP2;1 را بیان می‌کند. (e)  نشان دار کردن غشا پلاسمایی پروتوپلاست مزوفیل در شکل (d) با مارکر اختصاصی غشا پلاسمایی (FM4-64). (f) ادغام تصاویر (d) و (e).

 

 

شکل 3: حضور آکواپورین NtPIP2;1 در ساختارهای وزیکولی (فلش) در مجاورت غشا.

 

بر خلافNtPIP2;1، پروتئین‌های GFP-NtPIP1;1 یا NtPIP1;1-GFP در غشا پلاسمایی مشاهده نشدند، بلکه درون ساختارهای داخلی در اطراف هسته، سیتوسول و نزدیک غشا پلاسمایی وجود دارند (همانگونه که از فلورسانت سبز حاصل از آن‌ها مشخص می‌باشد) (شکل 4).

 

شکل 4: تعیین مکان درون سلولی NtPIP1;1 متصل به GFP در ناحیه N-ترمینال آکواپورین

 

برای شناسایی ساختارهای داخلی حاوی پروتئین‌های NtPIP1;1-GPF و یا GFP-NtPIP1;1، پروتئین NtPIP1;1-GPF همراه با پروتئین YFP::HDEL (مارکر شبکه‏ی آندوپلاسمی متصل به پروتئین با فلورسانت زرد) (1) در پروتوپلاست‌های توتون با هم بیان شدند.

همانگونه که در شکل5 (a) و (b) نشان داده شده،NtPIP1;1-GFP  مکان درون سلولی مشابه با YFP::HDEL را نشان می‌دهد که ثابت می‌کند NtPIP1;1-GFP احتمالا در داخل شبکه آندوپلاسمی پروتوپلاست‌های توتون باقی می‌ماند.

 

 

شکل5: بیان توام NtPIP1;1-GFP با مارکر شبکه آندوپلاسمی، YFP::HDEL. (a) پروتوپلاست مزوفیل که NtPIP1;1-GFP را به طور موقت بیان می‌کند، (b) همان پروتوپلاست که مارکر شبکه آندوپلاسمی را بیان می‌کند.

 

بحث

در گیاهان آکواپورین‌های غشا پلاسمایی یا  PIPsبه دو گروه وابسته از لحاظ توالی تقسیم می‌شوند: PIP1s و PIP2s. که اعضای آن‌ها نه تنها  از لحاظ طول N و C ترمینال خود متفاوت هستند، بلکه فعالیت کانال آب متفاوتی را هنگام بیان در اووسیت‌های زنوپوس نشان می‌دهند (6). درحالیکه PIPls عموما در این میزبان هترولوگ خاموش می‌باشند، PIP2s فعالیت کانال آب بالایی را نشان می‌دهند.

مطالعات قبلی ما نشان داد هنگامی که NtPIP1;1 در اووسیت‌های Xenopus بیان شود فاقد فعالیت کانال آبی می‌باشد، در حالی‏که NtPIP2;1 فعالیت انتقال آب بالایی را در این سیستم نشان می‌دهد (8). بعلاوه مشاهد شد که NtPIP1;1 متصل به GFP، سیگنال سبز ضعیفی را در غشا اووسیت تولید می‌کند، در حالی که هنگام بیان توام باNtPIP2;1، نه تنها میزان NtPIP1;1 درغشا پلاسمایی افزایش یافته (شدت سیگنال سبز در غشا افزایش می‌یابد)، بلکه نفوذ پذیری آبی اسموتیک غشا نیز افزایش می‌یابد (8). اینطور به نظر می‌رسد که NtPIP1;1 به این دلیل فاقد فعالیت کانال آبی است که در غشا پلاسمایی قرار نمی‌گیرد. در تایید این مطلب ما نشان دادیم هنگامی که NtPIP1;1 متصل به GFP درپروتوپلاست‌های مزوفیل توتون به طور موقت بیان ‌شود، این آکواپورین به غشا پلاسمایی منتقل نشده (شکل4) و در داخل شبکه‏ی آندوپلاسمی باقی می‌ماند (شکل 5). اضافه کردن فلوروکروم GFP به NtPIP1;1 با حرکت آن در سلول تداخل نمی‌کند، زیرا هنگامی که GFP به C ترمینال یا N ترمینال NtPIP1;1 اضافه می‌شود در هر دو حالت، NtPIP1;1 در شبکة آندوپلاسمی باقی می‌ماند. بر خلاف NtPIP1;1، آکواپورینNtPIP2;1 درغشا پلاسمایی قرار می‌گیرد (شکل 2).

Zelazny و همکارانش (7) نیز نشان دادند که تمام ایزوفرم‌های ZmPIP1 ذرت مورد مطالعه نظیر ZmPIP1;1، ZmPIP1;2 و ZmPIP1;6 متصل به mCFP یا mYFP، هنگامی که در پروتوپلاست‌های مزوفیل ذرت بیان شوند، در داخل شبکه‏ی آندوپلاسمی باقی می‌مانند و مکانیسم حفاظت شده‌ای را برای باقی ماندن در ER نشان می‌دهند. این مکان یابی می‌تواند به علت حضور سیگنال‌های حبس در ER، نبود سیگنال‌های خروج و یا نیاز به اجتماع قبلی پروتئین باشد.. از طرفی بیان توام ZmPIP1s با ZmPIP2s متصل به YFP و یا CFP، منجر به اصلاح قرار گرفتن ZmPIP1s در غشا پلاسمایی می‌شود. با استفاده از تکنیک تصویر برداری میکروسکوپی FRET/Fluorescence life-time ، این محققین نشان دادند که این تغییر مکان ZmPIP1s از شبکه‏ی آندوپلاسمی به غشا پلاسمایی نتیجه‌ای از برهم کنش میان ZmPIP1s و ZmPIP2s می‌باشد. این داده‌ها پیشنهاد می‌کنند که بر هم کنش PIP1-PIP2 برای حرکت PIP1 به غشا پلاسمایی جهت تعدیل نفوذپذیری غشا پلاسمایی در گیاهان نیاز می‌باشند. این بر هم کنش‌ها، برای سلول‌ها یک مکانیسم اضافی را جهت تنظیم نفوذپذیری غشا فراهم می‌نمایند. ترکیب‌های مختلف هترومرهای PIP1-PIP2 در انواع سلولی خاص یا در پاسخ به علایم محیطی مختلف تا حد زیادی تنوع فعالیت کانال در غشاء را افزایش خواهند داد. این مکانیسم ممکن است با دیگر تغییرات پس از ترجمه‏ی آکواپورین‌های گیاهی از جمله فسفریلاسیون، پروتونه شدن، گلیکوزیلاسیون و متیلاسیون که باز و بسته شدن و جابه‌جایی کانال‌ها را در سلول کنترل می‌‌کنند، در ارتباط باشد.

تحقیقات اخیر با استفاده از موتان‌های گیاه آرابیدوپسیس که در آکواپورین  AtPIP1;2 نقص دارند نشان داد که هدایت آبی هیدرواستاتیک ریشه گیاه موتان بین 20 تا 30 درصد کاهش می‌یابد در حالی‏که هدایت آبی اسموتیک ریشه تغییری نمی‌کند (14). این نتایج نشان می‌دهد که ترکیب ایزوفرم‌های مختلف آکواپورین در گیاه نقش مهمی در تعیین میزان هدایت آبی گیاه دارند (14 و 15).

آکواپورین‌های NtPIP1;1 و NtPIP2;1 در بخش‌های مختلف گیاه توتون از جمله ریشه، برگ، گل، بساک و مادگی بیان می‌شوند (3)، ولی مکان دقیق آن‏ها در سلول و در گیاه کاملا مشخص نیست. به هر حال با استناد به مطالعات انجام شده حاضر می‌توان بیان داشت که NtPIP1;1 در داخل شبکه‏ی آندوپلاسمی و NtPIP2;1 در داخل غشا پلاسمایی قرار گرفته ولی برهمکنش و ترکیب این دو آکواپورین می‌تواند موجب اصلاح قرارگیری NtPIP1;1 در غشا پلاسمایی شود. همچنین برای بررسی نقش دقیق این دو آکواپورین در توتون نیاز به انجام مطالعات بر روی گیاهان موتان است که در حال حاضر موتانی که در هر یک از این آکواپورین‌ها نقص داشته باشد برای گیاه توتون موجود نیست.

 

نتیجهگیری

از مشاهدات میکروسکوپی بر روی پروتوپلاست‌هایی که پروتئین کانال آبی متصل به GFP را بطور موقت بیان می‌کنند می‌توان چنین نتیجه گرفت که کانال آبی NtPIP2;1 در غشا پلاسمایی سلول مستقر شده در حالیکه NtPIP1;1 در داخل شبکه آندوپلاسمی  باقی مانده و به غشا پلاسمایی منتقل نمی‌شود و به همین دلیل فاقد فعالیت انتقال آب است.

 

تشکر و قدردانی

این تحقیق با حمایت مالی دانشگاه اراک انجام شد. بدین وسیله از معاونت محترم پژوهش و فناوری آن دانشگاه کمال تشکر به عمل می‏آید.

1. Chaumont F, Barrieu F, Wojcik E, Chrispeels MJ, et al. Aquaporins constitute a large and highly divergent protein family in maize. Plant Physiol. 2001; 125: 1206-1215.

2. Johanson U, Gustavsson S. A new subfamily of major intrinsic proteins in plants. Mol. Biol. Evol. 2002; 19(4): 456-461.

3. Johanson U, Karlsson M, Johansson I, Gustavsson S, et al. The complete set of genes encoding major intrinsic proteins in Arabidopsis provides a framework for a new nomenclature for major intrinsic proteins in plants. Plant Physiol. 2001; 126(4): 1358-1369.

4. Chaumont F, Barrieu F, Jung R, Chrispeels MJ. Plasma membrane intrinsic proteins from maize cluster in two sequence subgroups with differential aquaporin activity. Plant Physiol. 2000; 122: 1025–1034.

5. Luu DT, Maurel C. Aquaporins in a challenging environment: molecular gears for adjusting plant water status. Plant, Cell Environ. 2005; 28: 85-96.

6. Fetter K, Van Wilder V, Moshelion M, Chaumont F. Interactions between plasma membrane aquaporins modulate their water channel activity. Plant Cell 2004; 16(1): 215-228.

7. Zelazny E, Borst JW, Muylaert M, Batoko H, et al. FRET imaging in living maize cells reveals that plasma membrane aquaporins interact to regulate their subcellular localization. Proc. Natl. Acad. Sci. USA 2007; 104: 12359-12364.

8. Mahdieh M, Mostajeran A, Horie T, Katsuhara M. Drought stress alters water relations and expression of PIP-type aquaporin genes in Nicotiana tabacum plants. Plant Cell Physiol. 2008; 49: 801-813.

9. Murashige T, Skoog F. A revised medium for rapid growth and bioassay with tobacco tissue cultures. Plant Physiol. 1962; 15: 473-479.

10. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual, 2nd Ed. Cold Spring Harbor Laboratory Press; 1999.

11. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA. 1977; 74(12):5463-5467.

12. Hosy E, Duby G, Very AA, Costa A, et al. A procedure for localization and electrophysiological characterization of ion channels heterologously expressed in a plant context. Plant Method. 2005; 1:1-14.

13. Batoko H, Zheng HQ, Hawes C, Moore I. A Rab1 GTPase is required for transport between the endoplasmic reticulum and Golgi apparatus and for normal Golgi movement in plants. Plant Cell 2000; 12(11): 2201-2218.

14. Postaire O, Tournaire-Roux C, Grondin A, Boursiac Y, et al. A PIP1 Aquaporin Contributes to Hydrostatic Pressure-Induced Water Transport in Both the Root and Rosette of Arabidopsis. Plant Physiol. 2010; 152(3): 1418-1430. 

15. Alexandersson E, Danielson J, Rade J, Moparthi VK, et al. Transcriptional    regulation of aquaporins in accessions of Arabidopsis in response to drought stress. Plant J. 2010; 61: 650-660.