انتقال و بیان ژن NGF در سلول‏های بنیادی مغز استخوان موش با استفاده از دو وکتور لنتی ویروسی HIV و FIV

نوع مقاله: علمی - پژوهشی

-

چکیده

هدف: در این مطالعه میزان انتقال بیان ژن توسط لنتی‌ ویروس‏های مشتق از ویروس نقصان ایمنی انسانی                                          “Human immunodeficiency virus”( HIV) با میزان انتقال بیان ژن توسط لنتی ویروس مشتق از ویروس نقصان ایمنی گربهImmunodeficiency virus (FIV)   Felineبه سلول‏های مزانشیمی مغز استخوان موش مورد مقایسه قرار گرفت.
مواد و روش‏ها: حامل های ویروسی با استفاده از وکتورهای آماده، سلول‏هایHEK-293T ، شاتل‏های لنتی ویروسی با پایه‏هایHIV  وFIV  حامل ژن GFP به عنوان کنترل، وFIV  وHIV  حامل ژن Nerve growth factor))NGF  تولید شدند. سپس سوپرناتانت سلول‏های HEK-293T حاوی ویروس‏های ساخته شده در معرض سلول‏های مزانشیمی مغز استخوان موش قرار گرفت.
نتایج: نتایج نشان داد ‏که سلول‏های مغز استخوان تیمار شده با وکتور  HIV-NGF، NGF را بیان کردند. اما پس از تیمار با وکتور FIV-NGF، فاقد این توانایی و قادر به بیان NGF نبودند. نتایج بیان NGF توسط نتایج انتخاب سلول‏ها، به وسیله آنتی بیوتیک، مورد تایید قرار گرفتند.
نتیجه گیری: لنتی ویروس‏های مشتق از FIV در مقایسه با لنتی ویروس‏های مشتق از HIV جهت آلوده سازی و بیان ژن خارجی در سلول‏های مزانشیمی مغز استخوان مناسب نیستند.
 

کلیدواژه‌ها


مقدمه

انتقال ژن در زمره مهم‏ترین تکنیک های مورد استفاده درمطالعات تکاملی و فیزیولوژیکی، تشخیص بیماری‏ها، درمان و پیشگیری از آن‌ها می‏باشد. به علت توانایی طبیعی ویروس‏ها در انتقال ژن و الحاق به ژنوم میزبان که بخشی ضروری از سیکل زندگی آن‏ها است، از آن‏ها بعنوان ابزاری قوی برای انتقال ژن‏های بیگانه به درون سلول‏های میزبان استفاده می شود (1). لنتی ویروس‌ها ناقلین ویروسی می‏باشند که به دلیل ویژگی‏های برجسته‌ای مانند اینتگراسیون،‌ تولید آسان و ترانسداکشن فراوان، در سال‏های اخیر مورد توجه قرار گرفته‌ اند. لنتی ویروس‏ها از خانواده رتروویریده می‏باشند و همانند رترو ویروس‌ها قادرند پس از ورود به سلول میزبان، ژن‏های خود را به داخل ژنوم میزبان وارد کنند. البته رتروویروس‌ها تنها قادر به آلوده سازی سلول‏های در حال تقسیم می‏باشند در حالیکه لنتی ویروس‏ها قادر به آلوده سازی سلول‏های تکثیرشونده و غیرقابل تکثیر هستند (2). وکتورهای رتروویروسی مشابه وکتورهای با پایه ویروس سرطان خون موشی (MLV) (murine leukemiavirus) می باشند ولی نسبت به آدنوویروس‏ها دارای مزایایی مانند بیان طولانی مدت ژن نوترکیب، عدم ایجاد پاسخ ایمنی ناخواسته و توانایی بیان نسبتا بالای یک ژن در انواع سلول‏های پستانداران هستند(3). لنتی ویروس ایدز (HIV) توانایی آلوده سازی سلول‏های درحال تقسیم و سلول‏های تکثیر ناپذیر را دارا بوده که این توانایی به علت عدم نیاز این ویروس‏ها به فاکتورهای مهم هسته ای برای انتقال به هسته می باشد. این وکتورها قابلیت انتقال ژن به سلول‏های اولیه در حال رشد و ماکروفاژهای تمایز یافته در شرایط آزمایشگاهی را دارا بوده و در vivo in نیز قابلیت انتقال ژن به نورون‏های تمایز یافته، سلول‏های شبکیه، کبد، ماهیچه و سلول‏های دیگری را دارند (4 و 5).  توانایی لنتی ویروس‏ها به‏عنوان حاملین مناسب انتقال ژن به سلول‏های مختلف انسان و پستانداران مخصوصا به بافت هایی مثل سیستم عصبی یا بافت کبد که دارای سلول‏های تقسیم ناپذیر می باشند، منجر به اهمیت روز افزون استفاده از آن‏ها شده است. از مهم‏ترین حامل‏های لنتی‏ویروسی می‏توان حامل‏های لنتی‏ویروسیFIV  مشتق ازFeline Immunodeficiency virus” ، حامل‏های لنتی‏ویروسی HIV مشتق از “Human immunodeficiency virus” و حامل های لنتی ویروسی SIV مشتق از Simian Immunodeficiency virus  را نام برد که عموما برای انتقال ژن مورد استفاده قرار می‏گیرند (6، 7 و 8). اگر چه لنتی ویروس‌های پریمات‎ها مانند SIV وHIV دارای ساختاری توسعه یافته می باشند، اما لنتی ویروس‌های غیرپریماتها نیز دارای توانایی‏های مشابهی می‏باشند که کمتر مورد توجه محققان قرار گرفته است. ویروس نقص ایمنیFIV  دارای ساختاری نسبتا مشابه با ویروس HIV است و می‏تواند مدل بسیار مناسبی برای گسترش تولید واکسن‏های نوترکیب و درمان بیماری‏های ویروسی باشد. از سوی دیگر این لنتی‏ویروس را می‏توان به منظور ایجاد وکتورهای مناسب‏تر جهت سازگاری با میزبان های مختلف بکار برد (9). آنالیز فیلوژنیک وکتور FIV نشان می‏دهد که این ویروس دارای فاصله نسبتا زیادی با لنتی‏ویروس‏های پریمات می باشد و شواهد اپیدمیولوژیک وقوع sero conversion (تولید آنتی بادی های اختصاصی قابل تشخیص برای میکروارگانیسم‏ها در سرم خونی که در نتیجه آلوده سازی یا ایمنی زایی تولید می شوند) در جوامع انسانی را نشان نمی‏دهد (10). بعضی از ویژگی های چرخه زندگی لنتی‏ویروس FIV شامل ورود و خروج از هسته، ادغام (integration) و سازماندهی پروموتر متفاوت از ویروس‏های پریماتها است. به همین دلیل این وکتورها می توانند به عنوان حامل‏های لنتی ویروسی دارای ایمنی بالاتر، برای انتقال ژن به انواع سلول‏های انسانی مورد استفاده قرار گیرند. ویروس FIV که از طریق قرار گرفتن در معرض مخاط منتقل می شود دارای ساختار کلی مشابه با ویروس‏های HIV می باشد، ولی تفاوت‏هایی از جمله تفاوت در اندازه ژنوم (9400 نوکلئوتید در ژنوم (FIV، نوع گیرنده موجود در سطح سلول هدف CXCR4) گیرنده ورود FIV به سلول هدف گیرنده) و در بعضی از پروتئین‏های کمکی به‏چشم می‏خورد (9، 10 و 11). یکی از ژن‏های کاندید جهت درمان بسیاری از بیماری‏های نورولوژیک، ژن نوروتروفین‏ها است که با بکارگیری از وکتورهای لنتی ویروسی به سلول‏های بنیادی قابل انتقال می‏باشد. نوروتروفین‏ها خانواده‏ای از فاکتورهای رشد می‏باشند که در تنظیم رشد، تعیین سرنوشت سلول، تمایز، عملکرد، و بقای سلول‏های عصبی نقش های مهمی دارند. سالهاست که بر نقش نوروتروفین ها در تمایز و بقای سلول های عصبی تاکید می‏شود. نوروترفین‏ها پروتئین‏های اندوژن حل شونده ای هستند (12، 13، 14، 15، 16 و 17) که باعث تنظیم بقا رشد،  تغییرات مورفولوژیک و همچنین سنتز پروتئین‏های دخیل در تمایز نورون ها می‏گردند.  از میان سلول‏های بنیادی سلول‏های بنیادی مزانشیمی با قابلیت تبدیل به انواع سلول‏ها از جمله سلول‏های عصبی و عدم تحریک سیستم ایمنی گزینه ای جذاب به‎حساب می آیند. بررسی بیان نوروتروفین NGF در این سلول‏ها حاکی از آن است که آنها بطور ذاتی این نوروتروفین را بیان می کنند (18). لذا در این مطالعه جهت افزایش بیان ژن NGF در سلول‏های بنیادی مزانشیمی از وکتورهای ویروسی FIV و HIVحامل NGF استفاده گردید و میزان توانایی این وکتورها در انتقال و بیان ژن NGF به این سلول‎ها مقایسه شد.

 

مواد و روش‌ها

تکثیر وکتورهای لنتی ویروسی: در این تحقیق از باکتری E.coli سویه  Top 10استفاده شد و طبق دستورالعمل زیر باکتری‏ها برای پذیرش پلاسمید مستعد شدند و سپس پلاسمید‏ها به آن‏ها انتقال داده شد.

تهیه سلول مستعد با استفاده از کلرید کلسیم ( :(CaCl2  برای تهیه سلول‌های باکتریایی مستعد از محلول 100 میلی مولارCaCl2  و آنتی‏بیوتیک های آمپی‏سیلین  با غلظت‏های نهایی (50 میکروگرم بر میلی لیتر) در محیط کشت، مورد استفاده قرار گرفت. پس از تهیه پلیت آگار حاوی آمپی‏سیلین، از استوک باکتری E.coli سویه Top10 بر روی پلیت کشت داده و سپس یک تک کلون از پلیت باکتری Top10 را تحت شرایط استریل برداشته و در محیط کشت مایع کشت داده شد تا جذب نوری آن در طول موج 500 نانومتر به 450 برسد. سپس محیط کشت داده شده حاوی گونه باکتری Top10 را سانتریفیوژ (10 دقیقه5000 rpm ) و پس از تخلیه محلول رویی به رسوب حاصل از سانتریفیوژ 100 میلی مولارCaCl2  اضافه شد. پس از انکوبه شدن (30 دقیقه در 4 درجه سانتی گراد)، سانتریفوژ، مراحل بالا تکرار و در ویال های استریل به دمای 70 -  درجه سانتی گراد انتقال داده شدند.

ترانسفورماسیون: برای ازدیاد پلاسمید هریک از پلاسمیدها به باکتری اشرشیاکلی Top10 وارد شدند. برای ترانسفورماسیون پلاسمیدها، ابتدا به 500 میکرو لیتر از باکتری مستعد شده اشرشیاکلی Top10، یک نوع پلاسمید (5 میکرولیتر) اضافه شد و پس ازمخلوط شدن آرام 30 دقیقه‏ای در دمای اتاق (90 ثانیه در بن ماری 42 درجه سانتی گراد) قرار گرفتند. پس از افزودن LB مایع به هریک از لوله‏ها (1ساعت،rpm 1000، 37 درجه سانتی گراد) هریک از سوسپانسیون‏های سلولی، روی پلیت LB-آگار دارای آمپی سیلین کشت شد و به این ترتیب اجازه رشد به تک کلنی های حاوی پلاسمید مقاوم به آمپی سیلین over night) ،37 درجه سانتی‏گراد) داده شد.

استخراج پلاسمیدها به مقدار زیاد (Maxi prep): ابتدا یک تک کلنی از پلیت کشت داده شده از پلاسمیدهای نوترکیب در محیط کشت مایع استریل حاوی آنتی بیوتیک آمپی سیلین کشت داده شد و سپس به روش ارائه شده در بروشور شرکت (Qiagen) و از فیلتر مخصوص کیت برای جدا سازی DNA استفاده شد. بعد از عبور محلول از فیلتر بافر شستشو از ستون فیلتردار عبور داده شد. پس از خشک شدن، رسوب DNA های نوترکیب با آب مقطر شستشو داده شد. پلاسمیدهای استخراج شده در دمای20- درجه سانتی گراد تا زمان انجام آزمایش ذخیره شدند.

انتقال وکتورهای لنتی ویروسی به رده سلولی 293T HEK (Transfection): سلول‏های HEK-293T به دلیل توانایی بالا در تکثیر و پروتئین سازی به عنوان سلول بسته بندی کننده وکتورهای لنتی ویروسی به صورت گسترده‏ای برای تولید انواع ویروس‏ها مورد استفاده قرار می‏گیرند. برای تولید لنتی‏ویروس‏های نوترکیب فعال، سلول‏های مولد ویروس همزمان با سه ناقل لنتی ویروس شاملpackage envelope  با روش رسوب DNA–کلسیم ترانسفکت شدند. تولید لنتی ویروس با کمک وکتورهای pMD2G ، pPSPAX2 و وکتور ترانسفر (ژن مورد نظر ما توسط شرکتGeneCoepia  کلون و خریداری شد). این وکتورهای لنتی ویروسی از نسل دوم بوده که ذیلا راجع به خصوصیات آن‏ها اشاره شده است. مخلوط DNA ویروسی شامل 2/10میکروگرم از وکتور pMD2G (بیان کننده پوشش گلیکوپروتئینی ویروس تورم تاولی دهان)، 2/10 میکروگرم از وکتور pSPAX2 (بیان کننده پروتئین‏های gag, pol, tatو rev) و 2/13 میکروگرم از وکتور 156 pEZLV و یا pEZLV2  (شاتل‏های لنتی‏ویروسی حامل  NGFو GFP خریداری شده از شرکت GeneCoepia) بود. پلاسمیدهای  ترانسفر برایHIV based- NGF  ((Lv156 و برایFIV based-NGF (Lv23) (شرکت (GeneCoepia بودند. جهت Transfection از یک‏سو به ناقلین لنتی ویروسی و از سوی دیگر به سلول‏های مولد ویروس نیاز بود. تولید لنتی ویروسی با انتقال ژن به داخل سلول مولد ویروس صورت پذیرفت که اصطلاحا ترانسفکشن خوانده می‏شود. برای این کار 24 ساعت قبل سلول‏ها به تعداد تقریبی 5/2 تا 3 میلیون برای هر پلیت 10 سانتی در محیط DMEM + 10درصد سرم کشت داده شدند. سپس سه پلاسمید لنتی ویروسی شامل ناقل وکتورtransfer  (5/11 میکروگرم) در دو وکتور HIV based وFIV based ، ناقل بسته بندی ویروس (Packaging Vector) (7 میکروگرم) و ناقل مربوط به غشاء ویروسی (5/4 میکروگرم)، بودند استفاده شدند. پلاسمید لنتی‏ویروسی وکتور GFP نیز به عنوان کنترل مورد آزمون قرار گرفت. ترانسفکشن به روش رسوب DNA – کلسیم فسفات انجام شد. مخلوط DNA - کلرید کلسیم قطره قطره به سلول‎ها اضافه شد و به‏ مدت 6 تا 8 ساعت انکوبه گردید تا DNA وارد سلول‏ها گردد. برای ممانعت از آسیب فسفات کلسیم به سلول‏ها، محیط سلول‏ها تعویض و یک‏بار با PBS شستشو شده و با افزودن محیط جدید به آن‏ها (24 تا 48 ساعت و 37 درجه سانتی‏گراد) کشت داده شدند. در این فاصله زمانی ذرات ویریونی پس از تشکیل در درون سلول‏ها به فضای خارج سیتوپلاسمی رها شدند.

تغلیظ ویروسی و آلوده سازی سلولهای هدف (Infection): محیط‏های ویروسی جمع آوری شده در مرحله تولید ترانسفکشن با رعایت تمام شرایط ایمنی و استریل به ستون‏های تغلیظ پروتئین (Amicon) منتقل (15 تا 20 دقیقه، 4 درجه سانتی‏گراد و rpm3500 ( سانتریفوژ گردیدند. در موارد کافی نبودن مقدار محیط حاوی ویروس نوترکیب این مرحله برای 10 تا 15 دقیقه دیگر تکرار شد. محیط حاوی ویروس پس از گذشت 24 ساعت از تعویض محیط ترانسفکشن، جمع آوری و پس از سانتریفوژ به محیط سلول‏های هدف افزوده گردید. سلول‏های هدف شامل 293T HEK و یا سلول‏های مزانشیمی مغز استخوان موشی BMSC بودند. سلول‏های مزانشیمی مغز استخوان موشی پس از استخراج از استخوان فمور رت در پتری‏دیش کشت داده شدند. برای آزمون آلودگی (infection) به وسیله ویروس، رقت‏های سریالی از هر یک از ویروس‏های نوترکیب به سلولهای هدف کشت شده در پلیت 24 خانه اضافه شد. مشاهده GFP پس از 48 ساعت، بیانگر آلوده شدن به ویروس بود. حداکثر بیان GFP در این مطالعه پس از 144 ساعت بود.

روش وسترن بلات: استخراج پروتئین: پس از اتمام زمان آلودگی، محیط سلول‌ها خارج و فلاسک 2 بار با PBS سرد شست‌وشو داده شد. سپس به هر فلاسک T25 ، تریپسین اضافه و فلاسک برای 5 دقیقه در انکوباتور قرار گرفت. بعد از اطمینان از جدا شدن سلول‌ها از کف فلاسک، PBS دارای 10 درصد FBS به سلول‌ها اضافه شد و سوسپانسیون سلولی منتقل گردید. پس از (5 دقیقه،rpm  1500) محلول رویی دور ریخته و رسوب سلولی در PBS تعلیق و به یک ویال انتقال یافت. پس از سانتریفو,ژ (5 دقیقه، 4 درجه سانتی‎گراد، rpm500 (محلول رویی دور ریخته شد و رسوب سلولی یا برای نگه‏داری طولانی مدت در 70- درجه سانتی‏گراد قرار داده شد و یا مستقیما برای استخراج پروتئین، مورد استفاده قرار گرفت. به رسوب سلولی حاوی 500 تا 800 هزار سلول، بافر لیز کامل اضافه گردید. سپس به کمک یک سرنگ انسولین، رسوب سلولی حدود 10 بار پیپتاژ شد تا هیچ توده‌ی سلولی باقی نماند و ویال‌ها (20 دقیقه در دمای آزمایشگاه روی شیکر) و سپس (20 دقیقه، 4 درجه سانتی‏گراد و  rpm12000 (انجام شد. محلول رویی شامل پروتئین به یک ویال جدید منتقل شد تا غلظت آن اندازه‌گیری گردد.

پس از الکتروفورز پروتئین‏ها، آن‏ها بر روی PVDF ترانسفر و مراحل ایمونوبلاتینگ انجام شد:

1- قرار دادن بلات در محلول بلوک کننده (4 درجه سانتی‏گراد، overnight، شیکر) موجب می‏شود تا پروتئین‌های موجود در شیر خشک مانع از اتصال آنتی‌ بادی‌ها به نواحی فاقد پروتئین ‌گردد.

2- آبکشی سریع توسط TBST و اضافه نمودن آنتی بادی اولیه شامل:

آنتی بادی β-Actin (Sigma): رقیق شده با نسبت 1:25000 در TBST ، 1 ساعت در دمای آزمایشگاه و روی شیکر

آنتی بادی NGF Millipore)): رقیق شده با نسبت 1:2500 در TBST ، 1 ساعت در دمای آزمایشگاه و روی شیکر

3- جمع آوری آنتی بادی اولیه و 3 شست‌وشوی 10 دقیقه‌ای با TBST در دمای آزمایشگاه و روی شیکر

4- اضافه نمودن Anti-rabbit IgG HRP-Conjugated (SantaCruz): رقیق شده با نسبت 1:10000 در TBST، 1 ساعت در دمای آزمایشگاه و روی شیکر (برعلیه آنتی بادی NGF ( و یا آنتی بادی ثانویه موشیAnti-mouse IgG HRP-Conjugated (SantaCruz): رقیق شده با نسبت 1:10000 در TBST، 1 ساعت در دمای آزمایشگاه و روی شیکر (برعلیه آنتی بادی ‌ β-Actin)

5- جمع آوری آنتی بادی ثانویه و 3 شست‌وشوی 10 دقیقه‌ای با TBST در دمای آزمایشگاه و روی شیکر

6- اضافه کردن  ECL(شرکت زیست فناوران نجم) بر روی بلات به حدی که سطح را بپوشاند. پس از 5 دقیقه بلات درون یک نایلون و سپس در کاست عکاسی قرار گرفت. در اتاق تاریک فیلم X-ray ، بسته به شدت نور،  برای مدت زمان 1 ثانیه تا چند دقیقه روی بلات قرار گرفت. سپس فیلم درون داروی ظهور انداخته شد. پس از شست‌وشو با آب مقطر، فیلم را در داروی ثبوت قرار داده و پس از آن با آب شسته شد.

استخراج RNA: سلول‏ها پس از رسیدن به 80 درصد فراوانی سلولی (پس از 2 هفته) باPBS  شستشو و سپس تریپسینه گردیدند و تریپسین با محیط کشت حاوی سرم خنثی شد. سوسپانسیون سلولی سانتریفیوژ') 5,  ºC4, rpm1500 ( شد. رسوب سلولی در PBS  سوسپانس و دوباره سانتریفوژ (5دقیقه، 4 درجه سانتی‏گراد و rpm1500( گردید. رسوب سلولی برای استخراج RNA مورد استفاده قرار گرفت. رسوب سلولی به همان روش که در بخش قبل تشریح شد، آماده گردید. از محلول easy BLUE® (,INtron نانومهر) به این رسوب اضافه گردید. سپس به کمک سرنگ انسولین و سرسرنگ‌های G21، رسوب سلولی حدود 7 تا 8 بار پیپتاژ شد تا سلول‏های لیز شده RNA سلولی خارج شود. پس از گذشت 10 تا 15 دقیقه، کلروفرم به محلول اضافه شد (30 ثانیه تکان شدید در جهت بالا و پایین) و پس از 5 دقیقه سانتریفوژ (10 دقیقه، 4 درجه سانتی‏گراد و rpm 12000 (شد که منجر به تشکیل سه فاز تشکیل گردید. فاز آبی رنگ حاوی پروتئین‌ و ضایعات سلولی در پایین، فاز کدر شیری رنگ شامل DNA در وسط و فاز بی‌رنگ رویی حاوی RNA تمام سلول‌ها است. فاز رویی به یک ویال جدید منتقل و ایزوپروپانول به آن اضافه شد. ویال چند بار به آرامی واژگون گشت. ایزوپروپانول، RNA را رسوب می‌دهد. پس از 15 دقیقه انکوباسیون در دمای آزمایشگاه، سانتریفوژ (15 دقیقه، 4 درجه سانی‏گراد و  rpm12000 (انجام شد. ایزوپروپانول دور ریخته شد و اتانول 75% به رسوب RNA اضافه و دوباره سانتریفوژ)  7 دقیقه، 4 درجه سانتی‏گراد و rpm7500 (گردید. اتانول خارج و رسوب RNA در ویال با در باز قرار گرفت تا اتانول آن به طور کامل ولی نه در حد خیلی خشک تبخیر گردد. پس از آن رسوب درآب-DEPC حل شد. سپس 1 میکرولیتر از آن برداشته و با رقت 1:100 جذب آن در طول موج‌های 260 و 280 نانومتر خوانده شد. غلظت RNA استخراج شده به کمک فرمول زیر محاسبه گشت.

غلظت RNA (µg/ml) = عکس رقت × OD260 × 40

 سنتز cDNA : پیش از سنتز cDNA ، جهت حذف آلودگی احتمالی به DNA،RNA با (Roche (10u/μl) DNase I انکوبه شد. به این ترتیب که 2 میکروگرم از RNA با 1 میکرولیتر از DNase I مخلوط و حجم نهایی با آب-DEPC به 11 میکرولیتر رسانده شد. این مخلوط ابتدا (15 دقیقه، 4 درجه سانتی گراد) و سپس (10 دقیقه، 4 درجه سانتی گراد) قرار گرفت تا پس از حذف DNA ، آنزیم DNase I نیز غیرفعال گردد.در این مرحله 1 میکرولیتر از (40u/μl) Rando Hexamer به مخلوط اضافه گشت و ویال (5 دقیقه، 65 درجه سانتی گراد) تا loop احتمالی موجود در mRNAها وجود دارد، از بین رفته و هگزامر به خوبی به آن متصل گردند. سپس ویال به سرعت روی یخ قرار داده شد و سایر مواد به آن اضافه گردیدند:

5X Buffer µl4

dNTPs Mix (10mM) µl2

RNase Inhibitor (40u/μl) µl1

M-MuLV Reverse Transcriptase (20u/μl) µl1

Total µl20

ویال‌ها درون دستگاه Thermal Cycler قرار داده شدند و ابتدا (10 دقیقه، 25 درجه سانتی گراد)  سپس (1ساعت، 42 درجه سانتی ‏گراد) و در نهایت ) 5 دقیقه، 72 درجه سانتی گراد) انکوبه شدند. پس از اتمام مراحل، cDNA سنتز شده برای نگهداری طولانی مدت در فریزر 70- درجه سانتی گراد  قرار داده شد.

 

 RT-PCR ژنهای β-ACTIN و NGF

توالی پرایمرهای  β-ACTIN (طول قطعه= bp102)

F: 5`AAGGCCAACCGTGAAAAGAT 3`

R: 5’ACCAGAGGCATACAGGGACA 3`

توالی پرایمرهای  NGF )طول قطعه= bp117(

F: 5`AAT TAG GCT CCC TGG AGG TG3`

R: 5`TGA GCT TGG GTC CAG CAT 3`

جهت انجام PCR:

Template (cDNA) µl 1                 

PCR buffer (10X) µl 2

dNTPs (10mM) µl 6/1                 

MgCl2 (50mM) µl 1

Primers (5µM) µl 2         

ddH2O µl12

Taq DNA Polymerase µl4/0

Total µl20

طبق جدول زیر برنامه به دستگاه داده شد.

ایمونوسیتوشیمی پروتئین NGF: برای اثبات ثولید پروتئینNGF  تست ICC انجام  شد. ابتدا 104 × 5 سلول BMSCs آلوده شده با لنتی‏ویروس نو ترکیب دارای NGF و به همان میزان سلول BMSC آلوده نشده به عنوان کنترل در چاهک‏های جداگانه در پلیت 24 خانه کشت شدند (البته در چاهک‏ها لامل قرار داده شده بود و سلول‏ها روی لامل در پلیت 24 خانه کشت شدند). پس از دو روز، محیط کشت لامل‏های حاوی سلول خارج و با  PBS شستشو گردیدند. پس از آن، سلول‏ها با پارافرمالدهید سرد فیکس و با PBS شستشو شدند. در مرحله بعد، محلول بلاکینگ حاوی 1 درصدBSA  (20 دقیقه) اضافه و بعد از شستشوی مجدد با  PBST1درصد (PBS دارای 1 درصد Tween 20)، در آنتی بادی اولیه علیه NGF (60 دقیقه) انکوبه گردید. پس از شستشو، سلول‏ها با آنتی بادی ثانویه (45 دقیقه) انکوبه شدند. بعد از خارج کردن آنتی بادی ثانویه و شستشوی سلول‏ها، DAPI برای رنگ کردن هسته سلول‏ها استفاده شد. با استفاده از گلیسرول 90 درصدCover slip های حاوی سلول بر گلیسرول 90 درصد بر روی لام قرار گرفته و با میکروسکوپ مشاهده شدند.

 

 

قسمت

دما

زمان

تعداد سیکل

Initial Denaturation

°C94

'5

1

Denaturation

°C94

"30

35 (ژن β-ACTIN)

Annealing

°C56(  β-ACTIN)

"30

°C60 (NGF)

 

Extension

°C72

"30

45 (ژنNGF)

Final Extension

°C72

'5

1

 


آنالیز آماری

باندهایRT-PCR  و  Western blottingتوسط نرم افزار Labimage اسکن و دانسیته باندهای NGF نسبت به باند بتا اکتین نیمه کمی گردیدند و با آزمون Student t-Test مورد آنالیز آماری قرار گرفتند. سطح معنی داری 05/0P< در نظر گرفته شد.

 

نتایج

لنتی ویروس‏هایFIV  و HIV حاوی GFP قادر به ترانسفکت کردن سلول های HEK-293T می‏باشند.

سلول‏های HEK-293T بعد از ترانسفکشن با هر دو نوع وکتور حاوی GFP درصد بالایی از بیان GFP را نشان دادند و تفاوت محسوسی مشاهده نگردید (شکل 1).

 لنتی ویروس‏هایFIV  و HIV حاوی NGF هر دو قادر به آلوده سازی سلول‏های HEK-293T می‏باشند.

بطور طبیعی ژن NGF در سلول‏های HEK-293T بیان می‏شود که پس از آلوده سازی HEK-293T با ویروس FIV-NGF ، این افزایش بیان مشاهده شد. نتایج آزمون بیان NGFmRNA توسط RT-PCR در سلولهای HEK-293T آلوده شده با ویروس FIV-NGF نسبت به سلول‏های آلوده نشده نشان داد که این میزان 2 برابر شده است (شکل 2). البته همان طور که در شکل 2 مشاهده می گردد، این بیان هنوز کمتر از سلول‏های BMSC دست نخورده است که بطور طبیعی NGF را به میزان بالاتری از سلول‏های HEK-293T آلوده شده توسط ویروس FIV-NGF (7/1) برابر بیان می‏کنند. نتایج بدست آمده از تکنیک وسترن بلات (شکل3) نیز نشان داد که بیان نسبی پروتئین NGF (13 کیلو دالتون) به پروتئین بتا اکتین )98 کیلو دالتون( در سلول‏های HEK-293T آلوده شده توسط ویروس FIV-NGF 9/1 برابر افزایش داشته است، در حالی‏که در سلول‏های آلوده نشده، نسبت بیان NGF به بتا اکتین به میزان 7/0 برابر کمتر است.

 

 

شکل 1: مقایسه بیان GFP در سلول‏های آلوده شده HEK-293T توسط سازه های(A  FIV-GFP و(B  HIV-GFP. بررسی بیان GFP در سلول‏های HEK-293T بعد از ترانسفکشن با هر دو نوع وکتور حاوی GFP FIV based- GFP) و( HIV based GFP  درصد بالایی از بیان GFP را نشان دادند و تفاوت محسوسی میان دو وکتور مشاهده نگردید.

 

 

شکل 2: مقایسه بیان ژن NGF در سلولهای HEK-293T آلوده شده توسط ویروس NGF–FIV  و سلولهای BMSC  آلوده نشده.1- DNA marker 100 bp 2- سلولهای HEK-293T آلوده شده به ویروس  FIV-NGF3- سلول BMSC دست نخورده 4- سلول HEK-293T آلوده نشده 5- کنترل منفی (واکنش بدون cDNA). لنتی ویروسFIV  قادر آلوده سازی سلول های HEK-293T میباشد.

 

 

شکل 3: وسترن بلاتینگ بیان پروتئین NGF در سلول‏های HEK-293T A)) آلوده نشده و B)). آلوده شده به ویروس NGF– FIV. در این سلول‏ها باندNGF ، 13 کیلودالتونی می باشد. بیان NGF در سلول‏های HEK-293T آلوده شده توسط ویروس FIV-NGF نسبت به ژن بتا اکتین حدود 2 برابر بیشتر و درسلول‏های آلوده نشده 7/0 برابر کمتر می‏باشد.

 

 

فقط لنتی ویروس HIV و نهFIV  قادر به آلوده سازی سلول‏های BMSC می‏باشد.

آلوده سازی سلول‏های BMSC توسط سوپرناتانت بدست آمده از سلول‏های HEK-293T و سپس تیمار سلول‏های آلوده شده توسط آنتی بیوتیک G418، هیچ گونه مقاومتی نسبت به این آنتی بیوتیک در این سلول‏ها ایجاد نکرد. همچنین اگر چه در سلول‏هایBMSC  آلوده شده باHIV-GFP  پس از گذشت 48 ساعت بیان پروتئین GFP مشاهده گردید و بیان آن با استفاده از ایمونوسیتوشیمی تایید شد (شکل 4)، اما بیان مارکر (GFP) در سلول‏های C‍‍‍‍‍‍BMS آلوده شده با ژن FIV-GFP حتی با گذشت 48 تا 72 ساعت پس از آلوده سازی هم دیده نشد. به‏علاوه به دلیل آنکه این سلول‏ها ژن مقاومت به G418 را دریافت نکرده بودند، پس از 4 روز تیمار با G418 مرگ سلولی رخ داد. با تغییر زمان تیمار با G418 به مدتهای 24، 48 و 72 ساعت نیز تغییری در نتایج ایجاد نشد. همچنین با تغییر میزان دفعات آلودگی (2 الی 3 بار در روزهای متواالی) تغییری در نتایج ایجاد نشد و کماکان مرگ سلولی رخ داد. به ‏علاوه در یک‏سری از آزمایشات دیگر (نشان داده نشده است) ترنسفکشن مستقیم وکتور FIV-GFP بدون مداخله‏ی سلول‏های HEK-293T با استفاده از الکتروپوریشن (electroporation) سلول‏های هدف (BMSC) صورت گرفت، باز هم بیان قابل ملاحظه‏ای از GFP در BMSC دیده نشد. با تغییر در تعداد سلول‏های BMSC، به نسبت محیط ویروسی نیز تفاوتی در نتیجه اینفکشن ژن  FIV-NGF مشاهده نگردید و سه روز پس از تیمار با G418 سلول زنده‏ای مشاهده نشد.

 

شکل 4: بیان ژن  HIV-NGFدر سلول‏های BMSC:. سیتوپلاسم سلول‏های BMSC آلوده شده با ویروس نوترکیب HIV- NGF (فلش) دارای ژن NGF بوده و با آنتی بادی NGF قابل شناسایی هستند.

بحث

لنتی‏ویروس‏ها گزینه ای مناسب جهت انتقال ژن به سلول‏های بنیادی به‏حساب می‏آیند. روش‏های لنتی‏ویروسی بر روش‏های غیر ویروسی و بر روش‏های متکی بر  سایر ویروس‏ها نظیر رتروویروس‏ها ارجح است. علل استفاده از لنتی‏ویروس‏های نوترکیب 1- تولید این ویروس‏ها در تیتر بالا در عرض 48 ساعت 2- کارایی و تولید بالا 3 -عدم نیاز به عوامل ترنسفکت شده گران در سلول‏های مولد ویروس 4- سهولت آلوده سازی  سلول‏های تقسیم ناپذیر می‏باشند. لذا استفاده از لنتی‏ویروس‏ها علاوه بر بکارگیری سازه‏های تولید شده به منظور آلوده سازی سلول‏های بنیادی، مزایای دیگری نیز دارا هستند که از آن‏ها می‏توان 1- افزایش مقاومت نسبت به خاموشی ژنی        (Gene Silencing) 2- مسئله امنیت و سلامت استفاده از لنتی‏ویروس در مقایسه با سایر ویروس‏ها و وجود امکانات تشخیصی حساس به HIV در صورت تولید لنتی ویروس‏های بیماریزا را نام برد (19). وکتورهای لنتی  based-FIV به‏دلیل ایمن بودن برای انسان از لحاظ انتقال ژن در مقایسه با لنتی ویروس‏های-based  HIV مورد توجه خاصی قرار گرفته اند.  Poeschla و همکاران (8)، وکتورهای FIV را با عملکردی مناسب در مغز، چشم، گوش، ریه، کبد، ماهیچه، پانکراس و سیستم هماتوپویتیک معرفی کردند، اگر چه تا کنون مطالعات اندکی در مورد میزان موفقیت و کارآیی وکتورهای FIV جهت انتقال ژن به سلول‏های بنیادی صورت گرفته است (8). یافته‏های زیادی دال بر ژن درمانی با فاکتورهای رشد عصبی یا نوروتروفین‏ها درجهت تعدیل و یا پیشگیری از بیماری‏های نورولوژیک است. Bonner و همکاران با استفاده از لنتی‏ویروس حاوی ژن نوروتورفین BDNF در سلول‏های پیش ساز نورونی در موش‏های مدل جراحت نخاعی باعث رشد اعصاب قطع شده به سمت بافتهای هدف شدند (20). Park و همکاران با استفاده از لنتی ویروس حاوی ژن‏های نوروتورفین VEGF, IGF-I, GDNF،NT3، BDNF در موش‏های مدل ALS باعث بهبود عملکرد آن‏ها شدند (21). Zhang و همکاران (22) با استفاده از لنتی‏ویروس حاوی ژن‏های نوروتورفین NT3 در موش‏های مدل ایسکمی باعث بهبود عملکرد آن‏ها شدند (23). سلول‏های بنیادی غیرخونی در مغزاستخوان از گزینه‏های سلول درمانی در بیماری‏های نورولوژیک محسوب می‏شوند. این سلول‏ها دارای قابلیت تبدیل شدن به سلول‏های پیش سازعصبی هستند و به‏علاوه بطور ذاتی دارای توانایی تولید فاکتورهای رشد عصبی نوروتروفین‏ها هستند. از آن‏جا که میزان نوروتروفین‏های پایه این سلول‏ها اندک است، بایستی اقدام به افزایش بیان نوروتروفین‏ها در آن‏ها با استفاده از ژن درمانی کرد. لذا در این تحقیق سلول‏های بنیادی مغز استخوان دست ورزی شده با بکار گیری سیستم‏های لنتی‏ویروسی ژن نوروتروفین NGF به منظور استفاده از آن در مدل حیوانی بیماری مالتیپل اسکلروزیس مورد هدف قرار گرفتند. الحاق ژنی با بکارگیری سیستم‏های لنتی‏ویروسی صورت پذیرفت و تفاوت‏های کارآمدی دو وکتور ویروسیHIV based،FIV based  که هر دو حامل ژن NGF بودند مقایسه گردید. وکتورهای based-FIV بدلیل ایمن بودن برای انسان از لحاظ انتقال ژن در مقایسه با لنتی ویروس‏های-based  HIV مورد توجه خاصی قرار گرفته اند. وکتور FIV با وجود مزایایی در مقابل HIV ازجمله عدم القا پاسخ ایمنی در انسان و کارآمدی بالای انتقال ژن و آلوده سازی سلول‏های تقسیم ناپذیر پس از ایجاد تغییرات در پروموتر و ژنوم آن، هنوز کاملا مورد ارزیابی کامل واقع نشده است. در مطالعه حاضر، بررسی آلوده سازی سلول‏های بنیادی مغز استخوان با وکتورهای لنتی ویروسی FIV و HIV و آنالیز بیان ژن NGF صورت گرفت. نتایج بخش سلولی و آنالیز ایمونوراکتیویته NGF پس از استفاده از وکتور HIV-NGF در مقایسه باNGF-FIV ، تجمع سیتوپلاسمی پروتئین NGF در سلول‏های مغز استخوان را پس از استفاده از وکتور HIV-NGF و نه NGF-FIV نشان می‏دهد. همچنین آزمایشات RT-PCR نیز بیان mRNA NGF در این سلول‏ها را پس از HIV-NGF و نه FIV-NGF تائید کرد. به منظور تایید هر چه بیشتر این نتایج، آلودگی با استفاده از سلول‏های T293 نیز انجام شد. بر خلاف انتظار ما، بررسی سطح ترشحی میزان NGF در سلولهای T293 ترنسفکت شده با لنتی ویروسHIV based-NGF نسبت به سلول‏های T293 ترنسفکت شده با لنتی ویروس FIV based-NGF نشان داد که در این فاز هر دو وکتور قادر به آلوده سازی سلول‏های T293 هستند. این افزایش در میزان بیان پروتئین NGF تا حدی بالا بود که قابل سنجش و نمایش با تکنیک‏های وسترن بلاتینگ بود. این درحالی است که به ندرت می‏توان رفرانسی در مورد القای بیان این ژن و سنجش میزان بیان پروتئین NGF یافت. در مطالعات مختلف به بررسی بیان پروتئین گیرندهTrkA  توسط وسترن بلات بسنده شده است و نتایج حاصل از بیان پروتئین NGF ارائه نشده است (23). در هر صورت علی‏رغم آن‏که وکتورهای ویروسی FIV-NGF و HIV-NGF هر دو دارای توانایی آلودگی سلول‏های T293 بودند، عدم توانایی FIV-NGF در آلوده سازی سلول‏های بنیادی مغز استخوان مشاهده شد که دلیل آن برای ما مشخص نیست و نیاز به بررسی‏های بیشتر ملکولی و ساختاری در وکتور FIV-NGF را دارد. در مجموع پیشنهاد می‏شود تا در استفاده از وکتور FIV جهت ژن درمانی سلول‏های بنیادی پستانداران با تامل بیشتری گام برداشته شود.

 

نتیجه گیری

علی‏رغم آنکه در وکتورهای ویروسی با پایه FIV تغییراتی جهت پایدار سازی، تسهیل ورود ویروس و الحاق ژنی گزارش شده است، ولی در این مطالعه این امر اثبات نشد. سلول‏های مغز استخوان موش دریافت کننده وکتور FIV الحاق شده با ژن NGF قادر به زنده ماندن در محیط حاوی آنتی بیوتیک ایجاد کننده مقاومت در وکتور نبودند. در مجموع بر اساس یافته های این تحقیق، استفاده از وکتورهای با پایه FIV جهت الحاق ژنی در سلول‏های پستانداران پیشنهاد نمی‏شود.

 

تشکر و قدردانی

این مقاله با حمایت مالی پژوهشگاه ملی مهندسی ژنتیک و زیست فناوری به انجام رسیده است. در ضمن از سرکار خانم فاطمه وحید دستجردی و آقای مصطفی جمشیدی بابت خرید و در اختیار قرار دادن وکتور های کلون شده HIV-NGF و FIV-NGF صمیمانه سپاسگزاری می‏شود.

1. Kootstra NA, Verma IM. Gene therapy with viral vectors. Annu Rev Pharmacol Toxicol. 2003; 43: 413-439.

2. Quinonez R, Sutton RE. Lentiviral vectors for gene delivery into cells. DNA Cell Biol. 2002; 21(12): 937-951.

3. Saenz DT, Teo W, Olsen JC, Poeschla EM. Restriction of feline immunodeficiency virus by Ref1, Lv1, and primate TRIM5alpha proteins. J Virol 2005; 79(24): 15175-15188.

4. Kafri T, Blomer U, Peterson DA, Gage FH, et al. Sustained expression of genes delivered directly into liver and muscle by lentiviral vectors. Nat Genet 1997; 17(3): 314-317.

5. Naldini L, Blomer U, Gallay P, Ory D, et al. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 1996; 272(5259): 263-267.

 

6. Poeschla EM. Non-primate lentiviral vectors. Curr Opin Mol Ther. 2003; 5 (5): 529-540.

7. Poeschla EM. Primate and feline lentiviruses in current intrinsic immunity research: the cat is back. Vet Immunol Immunopathol. 2011; 143(3-4): 215-220.

8. Poeschla EM, Wong-Staal F, Looney DJ. Efficient transduction of nondividing human cells by feline immunodeficiency virus lentiviral vectors. Nat Med. 1998; 4(3):354-357.

9. Elder JH, Sundstrom M, de Rozieres S, de Parseval A, et al. Molecular mechanisms of FIV infection. Vet Immunol Immunopathol. 2008; 123 (1-2): 3-13.

10. Johnston JC, Gasmi M, Lim LE, Elder JH, et al. Minimum requirements for efficient transduction of dividing and nondividing cells by feline immunodeficiency virus vectors. J Virol. 1999; 73 (6): 4991-5000.

11. Poeschla EM, Looney DJ. CXCR4 is required by a nonprimate lentivirus: heterologous expression of feline immunodeficiency virus in human, rodent, and feline cells. J Virol. 1998; 72(8): 6858-6866.

12. Frielingsdorf H, Simpson DR, Thal LJ, Pizzo DP. Nerve growth factor promotes survival of new neurons in the adult hippocampus. Neurobiol Dis. 2007; 26(1): 47-55.

13. Heese K, Low JW, Inoue N. Nerve growth factor, neural stem cells and Alzheimer's disease. Neurosignals. 2006; 15(1): 1-12.

14. Hu Z, Ulfendahl M, Olivius NP. NGF stimulates extensive neurite outgrowth from implanted dorsal root ganglion neurons following transplantation into the adult rat inner ear. Neurobiol Dis. 2005; 18 (1): 184-192.

15. Lindsay RM. Role of neurotrophins and trk receptors in the development and maintenance of sensory neurons: an overview. Philos Trans R Soc Lond B Biol Sci. 1996; 351(1338): 365-373.

16. Memberg SP, Hall AK. Proliferation, differentiation, and survival of rat sensory neuron precursors in vitro require specific trophic factors. Mol Cell Neurosci. 1995; 6(4): 323-335.

17. Davies AM. The role of neurotrophins in the developing nervous system. J Neurobiol. 1994; 25 (11): 1334-1348.

18. Jiang J, Lv Z, Gu Y, Li J, et al. Adult rat mesenchymal stem cells differentiate into neuronal-like phenotype and express a variety of neuro-regulatory molecules in vitro. Neurosci Res. 2010; 66(1): 46-52.

19. Federico M. Ed. Lentivirus gene engineering protocols. Humana Press. 2003.

20. Bonner JF, Blesch A, Neuhuber B, Fischer I. Promoting directional axon growth from neural progenitors grafted into the injured spinal cord. J Neurosci Res. 2009; 88(6): 1182-1192.

21. Park S, Kim HT, Yun S, Kim IS, et al. Growth factor-expressing human neural progenitor cell grafts protect motor neurons but do not ameliorate motor performance and survival in ALS mice. Exp Mol Med. 2009; 41(7): 487-500.

22. Zhang ZH, Wang RZ, Li GL, Wei JJ, et al. Transplantation of neural stem cells modified by human neurotrophin-3 promotes functional recovery after transient focal cerebral ischemia in rats. Neurosci Lett. 2008; 444(3): 227-230.

23. Triaca V, Tirassa P. Circulating NGF antibody alters the distribution of NG2 and CD56 positive cells in the brain of an animal model of inflammatory disorder. Arch Ital Biol. 2003; 141(2-3): 127-139.