بررسی کمّی بیان ژن سوکروز سینتاز1 در گیاه گندم تحت تنش شوری

نوع مقاله: علمی - پژوهشی

نویسندگان

دانشگاه آزاد اسلامی واحد نیشابور، گروه زیست شناسی، نیشابور، ایران

-

چکیده

هدف: در این تحقیق اثر تنش شوری بر میزان بیان کمّی ژن سوکروز سینتاز1(Sus1)، محتوای نسبی آب و نسبت جذب سدیم به پتاسیم برگ‌های گندم بررسی شد.
موادوروش‏ها: دانه‌رست‌های گندم رقم بم تحت تاثیر غلظت‌های 100 و 200 میلی مولار کلریدسدیم قرار گرفتند و در زمان‌های صفر، 6، 12، 24 و 36 ساعت پس از اعمال تنش، تغییرات محتوای نسبی آب، نسبت جذب سدیم به پتاسیم توسط برگ‌ها و همچنین بیان کمی ژن Sus به‏روش QRT-PCR مورد مورد مطالعه قرار گرفت.
نتایج: نتایج حاکی از کاهش معنی‌دار محتوای نسبی آب، افزایش نسبت جذب سدیم به پتاسیم توسط برگ‌ها و بالا رفتن نسبی بیان ژن Sus1 در گیاهان تیمار شده نسبت به گروه شاهد بود.
نتیجهگیری: به‏طور کلی افزایش بیان ژن سوکروز سینتاز1  می‌تواند یکی از مکانیسم‌های احتمالی گیاه گندم در فرایند تحمل به تنش شوری باشد.
 

تازه های تحقیق

-

کلیدواژه‌ها


همه خاک‌ها حاوی برخی نمک‌های محلول در آب هستند. گیاهان مواد غذایی خود را به‏شکل نمک‌های محلول جذب می‌کنند، اما انباشتگی اضافی نمک‌ها در خاک، شوری خاک نامیده می‌شود (1). طبق گزارش مرکز بین‌المللی‌ اصلاح‌ گندم‌ و ذرت‌ (CIMMYT) 8 الی 10 درصد از مناطق تحت کشت گندم در کشورهای ایران، هند، پاکستان، لیبی و مکزیک تحت تاثیر شوری می‌باشند (2). شوری اثرات متفاوتی را در گیاهان مختلف، همچون کاهش رشد (3 و 4)، کاهش سطح برگ‌ها (5)، تغییر در تعداد و اندازه روزنه‌ها (6)، زود چوبی ‌شدن ریشه‌ها (7و8) و جلوگیری از تمایز یافتن آوندهای چوبی و آبکش (7) برجای می‌گذارد. علاوه بر موارد بالا، شوری چندین جنبه از رشد زایشی را نیز تحت تاثیر قرار می‌دهد که شامل گل‏دهی، گرده افشانی، تکوین میوه، محصول و کیفیت دانه می‌باشد (9).

در سطح سلولی اقداماتی که جهت مقابله با شوری صورت می‌گیرد را می‌توان شامل کد‌بندی درون سلولی، سنتز محافظت کننده‌های اسمزی، تحمل نسبت به Na+ بالای سیتوپلاسمی، پاسخ به آسیب‌های حاصل از شوری و ترمیم آن‌ها، تغییر در بیان ژن و مسیرهای علامت‌دهی دانست (10 و 11). در تحقیقیKawasaki  و همکاران (12) الگوی بیان 1728 ژن را در پاسخ به تنش شوری در گیاه برنج با روش ریز آرایه مورد بررسی قرار دادند. در پژوهشی دیگرKawaura  و همکاران (13) نیز الگوی بیان 32000 ژن را در پاسخ به تنش شوری در گیاه گندم بررسی نمودند. به‏طور کلی 3416 ژن در شرایط شوری افزایش و 2580 ژن نیز کاهش بیان را نشان دادند. شناسایی ژن‌های جدید و تعیین الگوی بیان آن‌ها با هدف سازگار نمودن گیاهان به انواع تنش‌ها انجام می‌شود و باید در این راستا راه‏کارهای موثری در اصلاح گیاهان جهت بهبود تحمل تنش ایجاد شود (14).

آنزیم سوکروز سینتاز با داشتن قابلیت برگشتی، تبدیل ساکارز را به یوریدین دی فسفات گلوکز و فروکتوز بر عهده دارد (15) که اولین قدم از تبدیل سوکروز به نشاسته است و از این نظر ورود کربن به مسیر بیوسنتز نشاسته را کنترل می‌نماید (16). سوکروز سینتاز با جابه‌جا نمودن سوکروز بین بیوسنتز دیواره سلولی و گلیکولیز، یک نقش ممتاز در زمان کمبود اکسیژن بازی می‌کند به گونه‌ای که الگوی رسوب سلولز با مناطق فعالیت بالای سوکروز سینتاز همبستگی دارد (17).

سطح و توزیع فعالیت سوکروز سینتاز در بافت‌های مختلف، نگرش معنی‌داری نسبت به انتقال و مصرف کربوهیدرات‌ها در طول رشد گیاه و پاسخ گیاه به تنش‌های مختلف محیطی را فراهم می‌کند (18 و 19). در برخی از گونه‌های گیاهی مانند گندم، بیان ژن Sus در درجه حرارت پایین افزایش می‌یابد، که می‌تواند کمک مضاعفی برای مواجهه با افزایش تقاضای ناشی از فرآیند گلیکولیتیک باشد (20 و 24). مطالعات نشان داده است که افزایش بیان سوکروز سینتاز موجب تغییر در بیان ژن‌های دخیل در فرآیندهای متعددی مانند سوخت و ساز کربوهیدرات‌ها، آمینواسیدها، لیپیدها، بیوسنتز دیواره‌ها، تبدیل انرژی، تولید متابولیت‌های ثانویه، ساخت و حفاظت پروتئین‌ها و پاسخ به تنش‌ها می‌شود (15). به‏طور کلی مشاهده شده است سوکروز سینتاز یکی از ژن‌هایی است که بیان آن در گیاهان تحت تنش تغییر می‌کند (21).

در گندم و جو، دو ژن Sus (Sus1 و Sus2) وجود دارد که هر کدام از آن‌ها برای برخی بافت‌ها اختصاصی می‌باشند. ژن‌های Sus1 و Sus2 گندم در بازوی کوتاه گروه کروموزوم‌های یکسان 7 جدا سازی و نقشه گذاری شده‌اند. در صورتی‏که جایگاه این ژن‌ها در جو به‌ترتیب روی کروموزوم‌های 7HS و 2HS مشخص شده است (22و 25). Sus2  فقط در اندوسپرم بیان می‌شود درحالی‏که Sus1  هم در ریشه و هم برگ‌ها بیان می‌شود (22 و 23).

در این پژوهش، میزان کمّی بیان ژن سوکروز سینتاز 1 در سطح mRNA به‏روش Real – Time PCR و همچنین محتوای نسبی آب و نسبت یون سدیم جذب شده به پتاسیم برگ‌ها در فواصل زمانی پس از اعمال تنش شوری در رقمی متحمل به شوری از گندم، ارزیابی شد.

مواد و روش‏ها

شرایطرشدگیاهانواعمالتنش: این پژوهش به‏صورت فاکتوریل و در قالب طرح کاملا تصادفی با سه تکرار و در محل آزمایشگاه‌های دانشکده علوم پایه دانشگاه آزاد اسلامی واحد نیشابور در سال 1393 انجام شد. بذر گندم رقم بم، که به‏عنوان یک رقم متحمل به شوری شناخته می‌شود از موسسه اصلاح نهال و بذر کرج تهیه شد.

در ابتدا بذرها به‏وسیله هیپوکلریت سدیم 5 درصد و اتانول 7 درصد ضدعفونی و چندین بار توسط آب مقطر استریل شستشو و آبکشی شدند. بذرها در گلدان‌های هم شکل و هم‌اندازه حاوی ماسه با دانه‌های متوسط و ریز کشت داده شدند و به‏صورت روزانه توسط آب مقطر استریل، آبیاری شدند. از روز دوم بعد از جوانه‌زنی تعذیه گیاهان با محلول هوگلند 25 درصد شروع گشد و به تناوب هر دو روز غلظت هوگلند افزایش ‌یافت.

دانه‌رست‌‌های هشت روزه با غلظت‌های صفر، 100 و 200 میلی‏مولار کلرید سدیم تیمار شدند. در سطح صفر نمک یا گروه کنترل، گلدان‌ها با هوگلند فاقد نمک کلرید سدیم آبیاری شدند. در سایر سطوح نیز مقدار معینی NaCl درون هوگلند حل شد تا غلظت‌های مورد نظر حاصل شود. گلدان‌ها در دو نوبت و  به ‌فاصله 24ساعت با غلظت‌های مربوطه تیمار شدند.

نمونه برداری در زمان‌های 0، 6، 12، 24 و 36 ساعت پس از اولین نوبت اعمال تنش، صورت گرفت. در زمان نمونه‌برداری آخرین برگ تکامل یافته جهت محاسبه ﻣﺤﺘﻮای ﻧﺴﺒﻲ آب (RWC) جدا گردید و بر اساس پروتکل مربوطه عمل شد، چند برگ دیگر هم برای سنجش مقدار سدیم و پتاسیم برگ‌ها و همچنین بررسی بیان کمّی ژن سوکروز سینتاز1 پس از جمع‌آوری و قرار گرفتن در نیتروژن مایع، به فریزر منفی70 درجه سانتی‌گراد منتقل شدند.

استخراج RNA: استخراج RNA با کیت جداسازی RNA کل شرکت دنا زیست انجام شد. برای این کار حدود 100 میلی‌گرم بافت گیاهی به‏همراه نیتروژن مایع درون یک لوله اپندورف سرد با استفاده از میله شیشه‌ای، به‏خوبی کوبیده و پودر شد و یک میلى‌لیتر بافر G1 به میکروتیوب اضافه و در 2 پریود زمانى 15 ثانیه به‏شدت ورتکس شد. پس از انکوبه شدن در دماى آزمایشگاه به‏مدت 5 دقیقه میکروتیوب‌ها به‏مدت 10 دقیقه در دماى 4 درجه سانتى‌گراد با سرعت 12000 دور بر دقیقه سانتریفیوژ شدند. محلول فوقانى لوله به میکروتیوب جدید منتقل شد و میزان 200 میکرولیتر کلروفرم به آن اضافه و به‏مدت 15 ثانیه به‏شدت لوله تکان داده یا ورتکس شد. لوله در دماى آزمایشگاه به‏مدت 3 دقیقه انکوبه شد و بعد از آن به‏مدت 15 دقیقه در دماى 4 درجه سانتى‏گراد با سرعت 12000 دور بر دقیقه سانتریفیوژ شد. فاز بالایى که حاوى RNA است به میکروتیوب جدیدى منتقل و به‏میزان نیمى از حجمش، به‏ترتیب ایزوپروپانول و بافر G2به آن اضافه شد. بعد از مخلوط کردن محتویات لوله و 10 دقیقه انکوبه شدن در دماى آزمایشگاه، به‏مدت 10 دقیقه در دماى 4 درجه سانتى‌گراد با سرعت 10000 دور بر دقیقه سانتریفیوژ شد. مایع رویى با احتیاط خارج و به رسوب باقى مانده یک میلى‌لیتر اتانول (70 درصد) که با آب فاقد ریبونوکلئاز تهیه شده است، اضافه شد و برای 5 دقیقه در دماى 4 درجه سانتى گراد با سرعت 10000 دور بر دقیقه مجددا سانتریفیوژ انجام  شد. سپس مایع رویى با احتیاط خارج و جهت خشک شدن رسوب، لوله با درب باز در دماى آزمایشگاه و زیر هود به‏مدت 15 دقیقه نگه‏داری شد. سپس به رسوب تقریبا خشک شده به‏میزان 30 تا 100 میکرولیتر آب فاقد RNase اضافه شد. محلول حاصل در مقادیر کوچکتر در دماى منفى80 درجه سانتى‌گراد براى انجام آزمایش‏ها بعدى نگه‏دارى شد.

ساخت Cdna: ساخت cDNA با استفاده از کیت (USA)Thermo Scientific  به‏شرح زیر انجام شد. 1 تا 2 میکروگرم RNA کل استخراجی که با DNase تیمار شده و در نهایت حجم آن با آب بدون RNAse به 10 میکرولیتر رسیده بود با 1 میکرولیتر (18) Oligo dT مخلوط و به‏مدت 5 دقیقه در دمای 75 درجه سانتی‌گراد قرار داده شد. 1 میکرولیتر RNase inhibitor (10u/µl)،  4 میکرولیتر 5X RT buffer، 2 میکرولیتر dNTP (10mM)، 2 میکرولیتر DTT (0.1M) و 5/0 میکرولیتر Avian Myeloblastosis Virus  Reverse Transcriptase enzyme (AMV RT) (10u/ µl) به‏ترتیب روی یخ به ویال‌ها افزوده و برای چند ثانیه اسپین ‌شدند. مخلوط فوق به‏مدت 60 دقیقه در 42 درجه سانتی‌گراد قرار گرفت (برای فعالیت آنزیم RT). واکنش با قرار دادن تیوب‌ها به‏مدت 10 دقیقه در دمای 70 درجه سانتی‌گراد متوقف و نمونه روی یخ سرد ‌شد.

طراحیآغازگر: آغازگرهای مربوط به ژن کنترل داخلی اکتین از مقاله Dubcovsky و همکاران (26) که اثر فتوپریود را بر تنظیم ژن‌های گل‌دهی گندم مورد بررسی قرار داده بود، استخراج شد. جهت طراحی آغازگرهای مخصوص ژن سوکروز سینتاز1 از توالی مربوط به‌ این ژن که در پایگاه اطلاعاتی NCBI با شماره دسترسی AJ001117.1 موجود است، استفاده شد. کار طراحی آغازگرها به‏وسیله نرم افزار GeneRunr صورت گرفت. ضمن در نظر گرفتن خصوصیات استاندارد آغازگرها برای طراحی، ازجمله طول آغازگر، دمای اتصال، درصد G و C، ایجاد دایمرهای احتمالی و لوپ یا حلقه در درون هریک از آغازگرها و نیز ΔG مناسب، آغازگرها با نرم افزارهای On-Line، مجدد مورد بررسی قرار گرفتند.

 

 

جدول 1: توالی و خصوصیات آغازگرهای سوکروز سینتاز1 و اکتین

Self 3' complementarity

Self complementarity

GC درصد

دمای ذوب (Tm)

طول نوکلئوتیدی

طول قطعه سنتز شده

توالی

5´ - 3´

نام آغازگر

4

4

0/50

44/61

22

121

TGTTCGCAATGGTGAGCTGTAC

Sus Forward

4

4

62/47

73/59

21

121

TGTCGGCAAACCACATTCATG

Sus Reverse

3

5

50

18/60

20

90

ACCTTCAGTTGCCCAGCAAT

Act Forward

2

4

50

67/61

24

90

CAGAGTCGAGCACAATACCAGTTG

Act Reverse

 

 

انجامروش:QRT-PCR  مقایسه کمی بیان ژن‌ Sus1 از روش Real time SYBER Green PCR با استفاده از دستگاه ABI(Applied Biosystems step-one) صورت گرفت. cDNA ساخته شده به‏عنوان الگو مورد استفاده قرار گرفت و واکنش‌های qRT – PCR با پرایمرهای اختصاصی Sus1 و ژن کنترل داخلی Act (جدول1) انجام شد. برای هر واکنش 3 تکرار در نظر گرفته شده بود. حجم مخلوط واکنش برای هر نمونه، 20 میکرولیتر شامل 10 میکرولیتر مخلوط SYBER Green، 3 میکرولیتر از cDNA ساخته شده، 4/0 میکرولیتر از هر یک از آغازگرهای اختصاصی پیشرو و پسرو با غلظت 10 میکرومول، 2/6 میکرولیتر آب مقطر استریل فاقد RNase، بود که پس از آماده و لود شدن در چاهک‌های پلیت مخصوص به دستگاه ABI منتقل شد. واکنش زنجیره‌ای پلی مراز با شرایط زیر انجام شد: 10 دقیقه در دمای 95 درجه سانتی گراد و 40 تکرار با چرخه‏های 15 ثانیه دردمای 95 درجه سانتی گراد، 15 ثانیه در دمای 60 درجه سانتی‌گراد جهت اتصال پرایمرها به الگو و 45 ثانیه در دمای 60 درجه سانتی گراد جهت سنتز cDNA. مقادیر بیان کمی ژن با مقایسه بین میزان بیان ژن در نمونه ها و کنترل با استفاده از روش ∆∆CT-2 محاسبه گردید.

محاسبه محتوای نسبی آب (RWC ): محاسبه ﻣﺤﺘﻮای ﻧﺴﺒﻲ آب به‏روش Ritchie و Nguyen (27) انجام شد. برای این منظور نمونه‌برداری با استفاده از قیچی از آخرین برگ نمو یافته تمامی تیمارهای آزمایشی انجام و نمونه­ها بلافاصله درون یخ قرار گرفت و در آزمایشگاه وزن تر آن‌ها با ترازوی دقیق (0001/0گرم) اندازه­گیری شد (برگ‌ها نباید دچار شکستگی و پارگی باشند). سپس تمامی نمونه­‏ها  به‏مدت 24 ساعت در دمای 4 درجه سانتی­‎گراد درون آب مقطر قرار ‌گرفتند. پس از آن، وزن اشباع برگ­ها اندازه­گیری شد و برگ­ها  به‏مدت 24 ساعت دیگر در دمای 70 درجه سانتی­‎گراد درون آون قرار گرفتند تا بعد از آن وزن خشک هر کدام از آن‌ها اندازه­‎گیری شود. با قرار دادن اعداد حاصل از توزین در فرمول زیر،RWC به‏دست ‌آمد:

RWC= Fw – Dw / Sw – Dw ×100

Fw: وزن تر برگ بلافاصله بعد از نمونه­‎برداری

Dw: وزن خشک برگ بعد از قرار گرفتن در آون

Sw: وزن اشباع برگ بعد از قرار گرفتن در آب مقطر

 اندازه گیری مقدار جذب سدیم و پتاسیم: جهت اندازه‌گیری میزان سدیم و پتاسیم برگ به روش EL-enany (28)، ابتدا اندام هوایی گیاهان برداشت شده و در دمای 70 درجه سانتی‌گراد به‏مدت 48 ساعت در آون خشک شدند. نمونه‌های خشک شده با استفاده از آسیاب پودر و برای انجام سایر مراحل آماده شدند. در ادامه 1/0 گرم از نمونه گیاهی آسیاب شده توزین و 10 میلی‏لیتر اسید استیک گلایسیال 1/0 نرمال به آن‌ها افزوده شد و  به‏مدت 24 ساعت در محیط آزمایشگاه نگه‏داری و پس از آن نمونه‌ها  به‏مدت دو ساعت درون حمام آب گرم (بن ماری) با دمای 70 درجه سانتی‌گراد قرار گرفتند. نمونه‌ها توسط قیف و کاغذ صافی (واتمن 41) صاف و عصاره حاصل به فالکون 15 میلی لیتری دیگری منتقل شد. حدود 15 تا 20 دقیقه قبل از قرائت، دستگاه فلیم فتومتر (مارک JENWAY، ساخت کشور انگلستان) روشن شد تا کاملا گرم شود و فیلتر دستگاه روی عنصر سدیم و یا پتاسیم بر حسب نیاز تنظیم ‌شد.

دستگاه ابتدا با آب مقطر و محلول استاندارد ppm 100 سدیم و

یا پتاسیم برای اعداد صفر و 100 کالیبره گردید.

عدد حاصل از دستگاه بر روی منحنی استاندارد مشخص شد و غلظت معادل آن به میلی‌گرم بر کیلوگرم به‏دست آمد. عدد حاصل از منحنی درون فرمول زیر قرار داده شد تا میزان سدیم یا پتاسیم بر حسب میلی‌گرم بر گرم محاسبه ‌گردد.

y × 10 × 0.001 × 10 = A  mg.g-1

A = میزان سدیم یا پتاسیم بر حسب میلی گرم بر گرم

y=  عدد حاصل از منحنی بر اساس میلی گرم بر کیلوگرم

 

آنالیز آماری

برای تجزیه واریانس داده‌های به‏دست آمده از نرم‌افزار SAS نسخه 9.1 استفاده شد. جهت مقایسه میانگین‌ها از آزمون LSD استفاده شد و سطح معنی‏داری 05/0p≤ لحاظ شد. رسم نمودارها توسط نرم‌افزار (Microsoft office 2013)Excel  انجام شد.

 

 

نتایج

استخراج RNA

جهت اطمینان از کیفیت، RNA استخراج شده مورد بررسى‏هاى کمّى و کیفى از طریق اندازه‌گیرى اسپکتروفتومترى و ژل الکتروفورز قرار گرفت. شکل 1 اندهای مربوط به RNA ریبوزومی s28 و s18 را نشان می دهد.



شکل 1: اطمینان از کیفیت RNA و مشاهده باندهای مربوط به RNA ریبوزومی  s28 و  s18

QRT-PCR

برای اطمینان از انجام موفق و هدفمند PCR محصول واکنش که به‏روش QRT-PCR انجام شده بود، روی ژل آگارز 2 درصد الکتروفورز گردید (شکل2). وجود تک باندهای مربوط به قطعات 121 جفت بازی از ژن Sus و 90 جفت بازی از ژن خانه‏دار Act نشان می‌دهد واکنش با موفقیت انجام شده است.

 

 

شکل 2: الکتروفورز محصول واکنش qRT – PCR روی ژل آگارز 2 درصد. خط 1 و 6: سایز مارکر 50bp شرکت Fermentase.خط2: قطعه تکثیر شده از ژن Sus1 به‏طول 121bp. خط 3: کنترل منفی Sus1. خط 4: قطعه تکثیر شده از ژن خانه دار Act به طول 90bp. خط 5: کنترل منفی ژن خانه دار Act

 

محتوای نسبی آب (RWC)

نتایج این تحقیق نشان داد، مقدار RWC برگ‌ها به‏طور معنی‌داری(001/0p<) در هر دو سطح شوری، نسبت به گروه کنترل کاهش یافت. از دیگر سو، گذشت زمان نیز بر کاهش مقدار RWC، دارای اثر معنی‏دار (0019/0p=) بود و بیشترین کاهش در زمان‌های 24 و 36 ساعت پس از تنش مشاهده شد. گیاهان تیمار شده با کلریدسدیم 200 میلی‌مولار، در تمامی زمان‌های مورد بررسی، به‌جز زمان صفر، نسبت به گروه‌های تیماری 100 میلی‌مولار کلریدسدیم و کنترل، کاهش معنی‏داری را نشان دادند (05/0p<). در حالی‏که تفاوت RWC در گروه تیمار شده با غلظت 100 میلی‌مولار نمک فقط در زمان‌های 24 و 36 ساعت پس از اعمال تنش با گروه کنترل معنی‏دار (05/0p<) بود (نمودار 1).

نسبت سدیم به پتاسیم جذب شده توسط برگ‌ها

نسبت جذب سدیم به پتاسیم توسط برگ‌ها در غلظت‌های صفر، 100 و 200 میلی‌مولار کلریدسدیم دارای تفاوتی معنی‏دار  (05/0p<) با هم بودند. در هر دو سطح شوری بالاترین نسبت (05/0p<) در زمان 36 ساعت پس از تنش محاسبه شد (نمودار 2).

 

 

 

نمودار1: تاثیر متقابل زمان و NaCl بر محتوای نسبی آب. میانگین ها حاصل 3 تکرار و حروف غیر مشترک نشانه اختلاف معنی‏دار در سطح 5 درصد بر اساس آزمون LSD است. بارها نشان دهنده خطای استاندارد می‌باشند. زمان‌ها متفاوت به‏طور مجزا مقایسه و حروف گذاری شده‌اند.

 

نمودار2: تاثیر متقابل زمان و NaCl بر نسبت سدیم جذب شده به‌یون پتاسیم توسط برگ‌ها. میانگین‏ها حاصل 3 تکرار و حروف غیر مشترک نشانه اختلاف معنی‏دار در سطح 5 درصد بر اساس آزمون LSD است. بارها نشان‌دهنده خطای استاندارد می‌باشند. زمان‌های متفاوت به‏طور مجزا مقایسه وحروف گذاری شده‌اند.

 

 

 


بیان نسبی ژن Sus1

انجام QRT-PCR  و تجزیه نتایج آن توسط دستگاهABI  نشان داد، در هر دو سطح شوری، بیان ژن Sus1 نسبت به گروه کنترل افزایش معنی‌داری (001/0p<)داشت. افزایش بیان، 6 ساعت بعد از اعمال تنش، در هر دو غلظت مورد مطالعه رخ داد به‏طوری‏که گیاه‏چه‌های تیمار شده با نمک 100 میلی‌مولار افزایش بیان 33/2 برابری و گروه تیماری 200 میلی‏مولار کلرید سدیم افزایش بیان 6/2 برابری را نسبت به کنترل نشان دادند. در 12 ساعت بعد از تنش در هر دو غلظت مورد استفاده نمک، بیان نسبی ژن Sus1 به‏ترتیب به‏میزان 78/3 و 55/4 برابر نسبت به کنترل افزایش یافت. اما در 24 ساعت پس از تنش، گروه‌های تیماری در هر دو سطح شوری، کاهش نسبی بیان را نسبت به زمان قبل نشان دادند. حال آنکه این کاهش در گروه تیماری 200 میلی مولار نمک بیشتر بود. در زمان 36 ساعت پس از تنش نیز گیاه‏چه‌ها افزایش شدیدتری را در بیان ژن Sus1 نشان دادند، در این زمان بیان نسبی ژن در گروه تیماری 100 میلی‏مولار نمک 93/5 برابر و در گروه تیمار شده با نمک 200 میلی‏مولار کلریدسدیم به میزان 08/7 برابر نسبت به شاهد بود (نمودار 3). به‏نظر می‏رسد افزایش بیان در زمان آخر را می‏توان به تشدید و تجمع شوری پس از نوبت دوم آبیاری گیاه‏چه‌های گندم در ساعت 24 بعد از تنش اولیه دانست.

 

 

نمودار 3: تاثیر متقابل زمان و NaCl بر بیان نسبی ژن Sus1 در برگ‌ها. میانگین‌ها حاصل 3 تکرار و حروف غیر مشترک نشانه اختلاف معنی‏دار در سطح 5 درصد بر اساس آزمون LSD است. بارها نشان‌دهنده خطای استاندارد می‌باشند. زمان‌های متفاوت به‏طور مجزا مقایسه و حروف گذاری شده‌اند

 

 

 

بحث

در این پژوهش، اثرات نمک کلریدسدیم با غلظت‌های 100 و 200 میلی‌مولار، بر محتوای نسبی آب ، نسبت سدیم به پتاسیم جذب شده توسط برگ‌ها و بیان نسبی ژن سوکروز سینتاز1 در گیاه‏چه‌های رقم بم گندم (متحمل به شوری) بررسی شد و نتایج حاصل با گروه کنترل مورد مقایسه قرار گرفت.

محتوای نسبی آب (RWC)

بر اساس نتایج تحقیق، مقدار RWC در هر دو غلظت به‏کار رفته از نمک، کاهش یافت. در این‏حال کاهش در غلظت 200 میلی‌مولار نمک بیشتر بود. از طرفی با گذشت زمان نیز مقدار RWC به‏شکل معنی‏داری در هر دو غلظت کاهش پیدا کرد. هم‏سو با نتایج این تحقیق، Zheng و همکاران (29)، Sairam و همکاران (30) و Shamsi و  Kobraee(31) کاهش RWC را تحت تنش شوری گزارش نموده‌اند.

تنش شوری همچون تنش‌های خشکی و سرما، علاوه بر سمّیت یونی از طریق کاهش محتوای آب سلول‌های گیاهی موجب کاهش عملکرد گیاهان زراعی می‌شود. ارزیابی وضعیت آب گیاه به‏علت آنکه می‌تواند از دقیقه‌ای به دقیقه دیگر متغییر باشد، بسیار مشکل است. چرا که باید عواملی همچون هدایت روزنه‌ای، شرایط فیزیومتریک و فشار محیط رشد به‏طور دقیق اندازه‌گیری شوند. در مقابل به‏راحتی می‌توان محتوای نسبی آب را اندازه‌گیری نمود (32). افزایش املاح محیط خارج سلولی گیاهان تیمار شده با نمک، باعث کاهش جذب آب در مقایسه با گیاهان کنترل می‌شود، لذا در گروه تیمار شده با شوری، RWC کم‌تر خواهد بود (33). همچنین احتمالا میزان اشباع فسفولیپیدها با افزایش شوری زیاد شده و در نتیجه سیالیت غشا کاهش یافته و در نهایت نشت آن افزایش می‌یابد (34). در این شرایط وظیفه غشاهای زیستی مختل و محتوای نسبی آب برگ کاهش می‌یابد.

نسبت سدیم به پتاسیم جذب شده توسط برگ‌ها

نسبت سدیم به پتاسم در گیاه به‏عنوان یک عامل مهم جهت تعیین میزان تحمل گیاه به شوری، مورد استفاده قرار می‌گیرد (35). بر اساس نتایج پژوهش حاضر هر دو غلظت مورد مطالعه شوری، باعث افزایش چشم‌گیر نسبت سدیم به پتاسیم جذب شده توسط برگ‌ها شد. افزایش غلظت یون Na+ و افزایش نسبتNa+/ K+  در شرایط تنش شوری در منابع متعددی گزارش شده است (36 و 37). در گندم مشخص شده است که تحمل نسبت به شوری با انتقال مقادیر پایینی از Na+  به بافت هوایی همراه با حفظ نسبت بالای K+/Na+ در ارتباط می‌باشد (34و38). به عبارتی در ارقام دارای تحمل شوری میزان تجمع کمتر یون Na+  و حفظ نسبت پایین K+/ Na+در اندام‏های جوان گیاه به‏عنوان شاخصی جهت بهبود تحمل شوری استفاده می‌شود (33 و 38). با توجه به موارد ذکر شده می‏توان نتیجه گرفت که کم‌تر بودن نسبت جذب سدیم به پتاسیم در گروه تیماری 100 به 200 میلی مولار شوری به‏علت فعال‌تر و نتیجه بخش‌تر بودن مکانیسم‌های مربوط به تحمل گیاه است.

بیان نسبی ژن Sus1

بر اساس نتایج این تحقیق، بیان ژن سوکرور سینتاز1 در گیاه‏چه‌های گندم تیمار شده با نمک کلریدسدیم نسبت به گروه کنترل افزایش یافت. همچنین مشخص شد، گروه تیمار شده با نمک 200 میلی‌مولار بیان نسبی بالاتری را نسبت به گروه تیمار شده با نمک 100 میلی‌مولار داشت. همان‏طور که گزارشات قبلی نشان می‌دهد. سرما، خشکی و تنش شوری از جمله تنش‌هایی هستند که منجر به دهیدراسیون و تنش اسمزی می‌شوند که متعاقب آن بیان آنزیم سوکروز سینتاز را تحریک می‌کنند (39). می‌توان از نتایج استنباط نمود، رقم بم که از متحمل‌ترین گندم‌های قابل کشت در ایران نسبت به شوری می‌باشد، در غلظت 200 میلی‌مولار نمک کلریدسدیم، دارای سیستم دفاعی فعال می‌باشد که به ماندگاری گیاه در این شرایط کمک می‌نماید. اگر چه سابقه‌ای از تحقیقات انجام شده در خصوص بررسی بیان این ژن در شرایط شوری و در گیاه گندم به‏دست نیامد، اما در تحقیقاتی افزایش بیان این ژن تحت تنش‌های سرما و کمبود اکسیژن را در برخی گیاهان گزارش شده است (17 و 40). عموما نمی‌توان یک ژن را مسئول اصلی پاسخ گیاه در برابر عامل تنش‌زا دانست بلکه باید در تحقیقات مستمر به‏دنبال یک سری از عوامل موثر در پاسخ‌دهی گیاه بود. در این بین برخی عوامل مستقیم و برخی دیگر به شکل غیر مستقیم قدرت پاسخ‌دهی و تحمل گیاه را افزایش می‌دهند. در تحقیقات گذشته وجود همبستگی بین رسوب سلولز در دیواره سلولی با بیان بالای ژن سوکروز سینتاز به اثبات رسیده است (17) که با توجه به نقش تنظیمی محصول این ژن در هدایت هدفمند کربوهیدرات‌ها به بیوسنتز دیواره سلولی و در نتیجه تقویت آن دور از انتظار نیست.

نتیجه گیری

هم‌راستای با بسیاری از تحقیقات گذشته، نسبت سدیم جذب شده به پتاسیم در برگ‌ها و محتوای نسبی آب آن‌ها در شرایط تنش شوری به‏ترتیب، افزایش و کاهش می‌یابند. با این توضیح که این تغییرات در غلظت بالاتر نمک شدیدتر می‌باشد. همچنین می‌توان ژن سوکروز سینتاز1 را جزء آن دسته از عوامل مفید و موثر در فرایند تحمل گندم به تنش شوری دانست. چرا که در شرایط این تنش و به‏خصوص غلظت بالاتر آن افزایش نسبی در میزان بیان این ژن اتفاق می‌افتد.

  1. Blaylock AD. Soil salinity, salt tolerance and growth potential of horticultural and landscape plants. Circular B988, Cooperative Extension Service, University of Wyoming, Laramie, WY, USA, 1994.
  2. Colmer T, Flowers T, Munns R. Use of wild relatives to improve salt tolerance in wheat. Journal of Experimental Botany.2006; 57: 1-20.
  3. Ali Y, Aslam Z, Ashraf MY, Tahir GR. Effect of salinity on chlorophyll concentration, leaf area, yield and yield component of rice genotypes grown under saline environment. Int. J. Environ. Sci. Technol. 2004; 1(3): 221- 225.
  4. Enferad A, Poustini K, Majnoon Hosseini N, Khajeh-Ahmad-Attari AA. Physiological responses of rapeseed (Brassica napus L.) varieties to salinity.
  5. J. Sci. Tech. Agric. Natur. Resour. 2004; 7(4):103- 113.
  6. Croser C, Renault S, Franklin J, Zwiazek J. The effect of salinity on the emergence and seedling growth of Picea mariana, Picea glauca, and Pinus banksiana. Environmental Pollution. 2001; 115(1): 9–16.
  7. Pattanagul W, Thitisaksakul M. Effect of salinity stress on growth and carbohydrate metabolism in three rice (Oryza sativa L.) cultivars differing in salinity tolerance. Indian Journal of Experimental Biology. 2008; 46(10): 736-742.
  8. Davis L, Sumner M, Stasolla C, Renault S. Salinity-induced changes in the root development of a northern woody species, Cornus sericea. Botany.2014; 92(8): 597-606.
  9. Cachorro P, Ortiz A, Barcelo AR, Cerda A. Lignin deposition in vascular tissues of Phaseolus vulgaris roots in response to salt stress. Phyton-Ann Rei Bot. 1993; 33:33-40.
 

10. Kozlowski TT.  Responses of woody plants to flooding and salinity. Tree Physiology Monograph. 1997; 1(1):1-29.

  1. 11.  Tester M, Davenport R. Na+ tolerance and Na+ transport in higher plants. Annals of Botany. 2003; 91(5): 503-527.
  2. 12.  Kamaluldeen J, Yunusa I, Zerihun A, Bruhl J, et al. Uptake and distribution of ions reveal contrasting tolerance mechanisms for soil and water salinity in okra (Abelmoschus esculentus) and tomato (Solanum esculentum). Agricultural Water Management. 2014; 146 95–104.
  3. 13.  Kawasaki S, Borchert C, Deyholos M, Wang H, et al. Gene expression profile during the initial phase of salt stress in Rice. The Plant Cell. 2001; 13(4): 889-905.
  4. 14.  Kawaura K, Mochida K, Yamazaki Y, Ogihara Y. Genome-wide analysis for identification of salt responsive in common wheat. Functinal Integrated Genomics. 2008; 8: 277-286.
15. Cushman J, Bohnert H. Genomic approaches to plant stress tolerance. Current Opinion in Plant Biology.2000; 3: 117-124.

  1. 16.  Fernandez EB, Munoz FJ, Montero M, Etxeberria Ed, et al. Enhancing Sucrose Synthase Activity in Transgenic Potato (Solanum tuberosum L.) Tubers Results in Increased Levels of Starch, ADPglucose and UDPglucose and Total Yield. Plant Cell Physiol. 2009; 50(9): 1651-1662.
  2. 17.  Jiang Q, Jian H, Chenyang H, Lanfen Wang, et al. The wheat (T. aestivum) sucrose synthase 2 gene (TaSus2) active in endosperm development is associated with yield traits. Funct Integr Genomics. 2011; 11:49–61.
  3. 18.  Albrecht G, Mustroph A. Localization of sucrose synthase in wheat roots: increased in situ activity of sucrose synthase correlates with cell wall thickening by cellulose deposition under hypoxia. Planta. 2003; 217(2): 252-260.
  4. 19.  Fallahi H, Scofield GN, Badger MR, Chow WS, et al. Localization of sucrose synthase in developing seed and siliques of Arabidopsis thaliana reveals diverse roles for SUS during development. J Exp Bot. 2008; 59(12): 3283-3295.
  5. 20.  Klotz KL, Haagenson DM. Wounding, anoxia and cold induce sugar beet sucrose synthase transcriptional changes that are unrelated to protein expression and activity. J Plant Physiol.2008; 165(4): 423-434.
  6. 21.  Sturm A, Tang GQ. The sucrose-cleaving enzymes of plants are crucial for development, growth and carbon partitioning. Trends in plant science. 1999; 4(10): 401-407.
  7. 22.  Cui S, Huang F, Wang J, Ma X, et.al. A proteomic analysis of cold stress responses in rice seedlings. Proteomics.2005; 5: 3162-3172.
  8. 23.  Maraña C, Garcla-Olmedo F, Carbonero P. Equivalent locations of sucrose synthase genes in chromosomes 7D of wheat, 7Ag of Agropyron elongatum, and 7H of barley. FEBS Letters. 1988; 234(2): 417–420.
  9. 24.  Jiang Q, Jian H, Chenyang H, Lanfen W, et al. The wheat (T. aestivum) sucrose synthase 2 gene (TaSus2) active in endosperm development is associated with yield traits. Funct Integr Genomics. 2011; 11(1): 49–61.
  10. 25.  Maraina C, Garcia-Olmedo F, Carbonero P. Differential expression of two types of sucrose synthase-encoding genes in wheat in response to anaerobiosis, cold stock and light. Gene. 1990; 88: 167-172.
  11. 26.  Martinez de Ilarduya O, Vicente-Carbajosa J, Sanchez de la Hoz P, Carbonero P. Sucrose synthase genes in barley. cDNA cloning of the Ss2 type and tissue-specific expression of Ss1 and Ss2. FEBS Lett. 1993; 320: 177–181.
  12. 27.  Dubcovsky J, Loukoianov A, Daolin Fu, Valarik M, et al. Effect of photoperiod on the regulation of wheat vernalization genes VRN1 and VRN2. Plant Molecular Biology. 2006; 60:469–480.
  13. 28.  Ritchie SW, Nguyen HT. Leaf water content and gas exchange parameters of two wheat genotypes differing in drought resistance. Crop Science. 1990; 30: 105-111.
  14. 29.  EL-enany AE. Effect of NaCl salinity on growth, pigment and mineral element contents, and gas exchange of broad bean and pea plants. Biologia Plantarum. 1994; 36(1): 75-81.
  15. 30.  Zheng Y, Zhenlin W, Xuezhen S, Aijun J, et al. Higher salinity tolerance cultivars of winter wheat relieved senescence at reproductive stage. Environmental and Experimental Botany. 2008; 62(2): 129–138.
  16. 31.  Sairam RK, Veerabhadra Rao K, Srivastava GC. Differential response of wheat genotypes to long term salinity stress in relation to oxidative stress, antioxidant activity and osmolyte concentration. Plant Sci. 2002; 163(5): 1037-1046.
  17. 32.  Shamsi K, Kobraee S. Biochemical and physiological responses of three wheat cultivars (Triticum aestivum L.) to salinity stress. Annals of Biological Research. 2013; 4(4): 180-185.
  18. 33.  Lafitte R. Relationship between leaf relative water content during reproductive stage water deficit and grain formation in rice. Field Crops Research. 2002; 76(2-3): 165–174.
  19. 34.  Munns R, Richard A, James, Andre´ La¨ uchli. Approaches to increasing the salt tolerance of wheat and other cereals. Journal of Experimental Botany. Plants and Salinity Special Issue. 2006; 57(5): 1025–1043.
  20. 35.  Song JQ, Mei XR, Fujiyama H. Adequate internal water status of NaCl salinized rice shoots enhanced selective calcium and potassium absorption. Soil Sci. Plant Nutr. 2006; 52(3): 300-304.
  21. 36.  Weimberg R. Solute adjustments in leaves of two species of wheat at two different stages of growth in response to salinity. Physiol. Plant. 1987; 70: 38-78.
  22. 37.  Schachtman DP, Munns R. Sodium accumulation in leaves for Triticum species that differ in salt tolerance. Aust. J. Plant Physiol. 1992; 19(3): 331-340.
  23. 38.  Wei G, Ji S, Lu Y, Feng J, et al. Isolation and analysis of genes preferentially expressed during early cotton fiber development by subtractive PCR and cDNA array. Nucleic Acids Research. 2003; 31(10): 2534-2543.
  24. 39.  Munns R, Tester M. Mechanisms of salinity tolerance. Annual Review of Plant Biology. 2008; 59: 651-658.
  25. 40.  Fernandes F, Arrabaca MC, Carvalho LMM. Sucrose metabolism in Lupinus albus L. under salt stress. Biol Plant. 2004; 48(2): 317–319.
  26. 41.  Zheng Y, Yong Wu, Wayne T Avigne, Karen E Koch. Differential regulation of sugar-sensitive sucrose synthases by hypoxia and anoxia indicate complementary transcriptional and posttranscriptional responses, Plant Physiol. 1998; 116(4): 1573–1583.