بررسی تاثیر عصاره هیدروالکلی گل قاصدک بر روی روند تکثیر سلول‏های بنیادی عصبی

نوع مقاله: علمی - پژوهشی

نویسندگان

1 دانشگاه آزاد اسلامی واحد اردبیل، دانشکده پزشکی، آزمایشگاه سلول‏های بنیادی، اردبیل، ایران

2 دانشگاه آزاد اسلامی، واحد اردبیل، باشگاه پژوهشگران جوان و نخبگان، اردبیل، ایران

3 دانشگاه علوم پزشکی اردبیل، دانشکده پزشکی، گروه علوم تشریحی و پاتولوژی، آزمایشگاه تحقیقاتی جنین شناسی و سلول‏های بنیادی

چکیده

هدف: هدف از این مطالعه بررسی تاثیر عصاره هیدروالکلی گل قاصدک (Cirsium vulgare) بر روی تکثیر و رشد سلول‏های بنیادی عصبی موش صحرایی در شرایط آزمایشگاهی (In vitro) می‏باشد.
مواد و روش‏ها: سلول‏های بنیادی عصبی از هیپوکمپ مغز نوزاد موش صحرایی استخراج شد. به‏منظور تعیین بهترین غلظت، سلول‏ها به‏مدت 48 ساعت با غلظت‏های 200، 400، 600، 800 و 1000 میکروگرم به‏ازای هر میلی‏لیتر محیط کشت تیمار شدند و میزان تکثیر سلولی با روش MTT بررسی گردید. همچنین میزان بیان ژن Sox2 در سلول‏های بنیادی عصبی تیمار شده با روش Real-time PCR بررسی گردید.
 نتایج: نتایج به‏دست آمده در این مطالعه نشان داد که در حضور عصاره گل قاصدک تکثیر سلول‏های بنیادی عصبی و بیان ژن Sox2 به‏طور معنی‏داری نسبت به گروه کنترل افزایش یافت.
 نتیجه گیری: با توجه به تاثیر عصاره گل قاصدک بر روی روند تکثیر سلول‏های بنیادی عصبی، استفاده از این عصاره گیاهی می‏تواند جهت مقاصد کلینیکی به‏منظور درمان برخی از بیماری‏های سیستم عصبی از جمله  ایسکمی مغزی و ضایعات نخاعی مفید باشد.

کلیدواژه‌ها


مقدمه

بیشترین مکان حضور سلول‏های بنیادی عصبی در نواحی ساب ونتریکولار می‏باشد (1). سلول‏های بنیادی عصبی توانایی تبدیل به اکثر سلول‏های تخصص یافته مغزی را دارا می باشند و در بیماری‏های سیستم عصبی این سلول‏ها قادرند به نقاط آسیب دیده مهاجرت کرده و در ترمیم شرکت کنند (2). این سلول‏ها بعد از تولد با حفظ توانایی خود تجدیدی می‏توانند در عمل‏کردهایی مانند یادگیری، حافظه و پاسخ به آسیب، تاثیر‏گذار باشد (3). استفاده از ظرفیت طبیعی بدن برای بازسازی و ترمیم یکی از اصول مهمی است که دانش سلول‏های بنیادی برای درمان بیماری‏ها دنبال می‏نماید (4). سلول‏های عصبی بعد از تولد مراحل پایانی تمایز خود را طی می‏کنند و توانایی خود تجدیدی را ندارند. بنابراین حضور سلول‏هایی که نورون‏زایی می‏کنند، در درمان ضایعات سیستم عصبی دارای اهمیت ویژه‏ای خواهد بود (5). یکی از مهم‏ترین مسائل در سلول درمانی استفاده از یک محرک مناسب برای افزایش سرعت تکثیر سلول‏های بنیادی عصبی در شرایطIn vitro  می‏باشد. ژن Sox2 به‏میزان زیادی در نورواپی‏تلیوم سیستم عصبی در حال تکوین بیان می‏شود. بر اساس مطالعات انجام شده این ژن در حفظ و تکثیر سلول‏های بنیادی عصبی نقش بسیار مهمی ایفا می‏نماید (6). گیاه سیرسیوم ولگار Cirsium vulgare که در زبان فارسی به قاصدک و در زبان انگلیسی به Spear Thistle شناخته می‏شود ، در مناطق مختلفی از اروپا، غرب آسیا و شمال غرب آفریقا یافت می‏گردد. تمام بخش‏های این گیاه به‏ویژه ریشه آن به‏عنوان دارو مورد استفاده قرار می‏گیرد. این گیاه به‏عنوان ضد تهوع، ضد رماتیسم، ضد درد، ضد التهاب و آنتی اکسیدانت مورد استفاده قرار می‏گیرد (7 و 8). بیشتر بررسی‏های انجام شده در رابطه با گیاهان متعلق به رده Cirsium مربوط به گیاه Cirsium japonicum می‏باشد. مطالعات انجام شده روی این گیاه نشان‏دهنده وجود فعالیت آنتی‏اکسیدانتی، ضدسرطانی (9) و ضد دیابتی (10) در این گیاه می‏باشد. تاکنون هیچ‏گونه مطالعه‏ای درباره اثر گیاه قاصدک بر روی سلول‏های بنیادی عصبی صورت نگرفته است. در این مطالعه برای اولین بار تاثیر عصاره هیدروالکلی گل این گیاه بر روی تکثیر سلول‏های بنیادی عصبی و بیان ژن Sox2 مورد بررسی قرار گرفته است.

 

مواد و روش‏ها

تهیه ﻋﺼﺎره هیدروالکلی گل ﮔﻴﺎه گل قاصدک: عصاره Cirsium vulgare به‏روش سوکسله ﺗﻬﻴﻪ و اﺛﺮ ﻏﻠﻈﺖ‏ﻫﺎی ﻣﺨﺘﻠﻒ آن ﺑﺮ روی رشد و تکثیر سلولی بنیادی عصبی(NSCs) مورد بررسی قرار گرفت. برای این منظور گیاه مورد نظر از اطراف شهر اردبیل درخرداد ماه  جمع آوری و در سایه و جریان هوا خشک  و توسط آسیاب پودر شدند. از پودر تهیه شده برای عصاره گیری به‏روش سوکسله استفاده شد. بدین‏صورت که 100 گرم از پودر آماده در کارتوش‏هایی که از کاغذ صافی معمولی با اندازه مناسب تهیه شده بود ریخته شد. سپس کارتوش‏ها را درون دستگاه سوکسله قرار داده و تقریبا به‏میزان  300 میلی‏لیتر مخلوط متانول و آب مقطر به‏عنوان حلال به آن اضافه گردید. عصاره گیری به‏مدت  12 ساعت ادامه یافت. عصاره به‏دست آمده به ظرف‏های شیشه‏ای منتقل شده و به‏مدت 24  ساعت بدون درپوش در آون 50 درجه نگه‏داری شد تا حلال باقی مانده تا حد امکان تبخیر شود .سپس عصاره تهیه شده برای آزمایش‏های بعدی در یخچال نگه‏داری شد.

جداسازی سلول‏های بنیادی عصبی: برای جداسازی سلول‏های بنیادی عصبی از  نوزاد موش صحرایی نژاد Sprague استفاده گردید. مراقبت و نگه‏داری از موش‏ها مطابق با آیین نامه مصوب کار با حیوانات آزمایشگاهی تصویب شده در دانشگاه تربیت مدرس تهران انجام گردید. بعد از بی‏هوشی کامل، بخش هیپوکامپ از دو نیمکره مغز جدا شده و پس از له کردن مکانیکی به‏میزان دو برابر بافت از آنزیم‏های Accutase و کلاژناز برای مدت 30 دقیقه در دمای 37 درجه سانتی‏گراد به‏منظور هضم آنزیمی استفاده گردید. در مرحله بعدی به‏منظور خنثی کردن آنزیم‏ها از سرم FBS (Fetal bovine serum) استفاده شد. سپس سوسپانسیون حاصله از فیلتر مش نایلونی 70 میکرومتری (Falcon 352350) عبور داده شد و به‏مدت 10 دقیقه در 3000 دور سانتریفوژ گردید. رسوب سلولی به‏دست آمده با محیط کشت DMEM/F12 حاوی فاکتورهای رشد BFGF human recombinant(Millipore)، Epidermal GrowthFactor(sigma) ، B-27 supplement (GIBCO)، پنی سیلین-استرپتومایسین (سیگما) یک درصد به‏همراه 3 درصد سرم  FBS در انکوباتور با دمای 37 درجه سانتی‏گراد و 5 درصد CO2 کشت داده شد. محیط کشت سلول‏ها پس از 24 ساعت تعویض شد و سلول‏های بنیادی عصبی که به کف فلاسک چسبیده بودند پس از رسیدن به تراکم 70 تا 80 درصد با استفاده از تریپسین از کف فلاسک جدا و با نسبت 1 به 2 پاساژ داده شدند. در این مطالعه از سلول‏های پاساژ سوم استفاده گردید. جهت تایید هویت سلول‏های بنیادی عصبی از آنتی‏بادی نستین و روش ایمونوسیتوشیمی استفاده شد. به این ترتیب که سلول‏ها توسط پارافرمالدهید 4 درصد در دمای اتاق و برای نیم‏ساعت فیکس شدند و پس از فیکساسیون و شستشو توسط PBS (Phosphate buffered saline) با  triton-100X/PBS3/0 درصد نفوذ پذیر شدند و سپس برای مدت یک ساعت با 10 سرم ضد بز در PBS  انکوبه می‏گردند. پس از شستشو، سلول‏ها توسط آنتی‏بادی اولیه برای مدت 12 ساعت در یخچال با دمای 4 درجه سانتی‏گراد قرار داده شد. پس از شستشوی کامل توسط PBS  با آنتی‏بادی ثانویه  کونژوگه به FITC (Fluorescein Isothiocyanate) انکوبه و پس از 2 ساعت سلول‏ها باPBS  شسته شده و توسط میکروسکوپ فلورسانس اینورت مشاهده شدند. هسته‏ها نیز مانند قبل با اتیدیوم بروماید رنگ‏آمیزی شدند. 

تیمار سلول‏های بنیادی عصبی با عصاره  Cirsium vulgare: سلول‏های بنیادی عصبی ایزوله شده از هیپوکمپ نوزاد موش صحرایی در یک گروه کنترل و پنج گروه تیمار شده با عصاره مورد نظر در پلیت های 96 خانه با غلظت‏های 200، 400، 600، 800 و 1000 میکرو‏گرم بر میلی‏لیتر به‏مدت 48 ساعت تیمار و مورد مطالعه قرار گرفتند. تیمار سلول‏ها در محیط کشت سلول‏های بنیادی عصبی و فاقد سرم انجام شد. به منظور بررسی‏های آماری دقیق 5 تکرار در نظر گرفته شد.                                

آزمون MTT: برای ارزیابی میزان تکثیر از روش (3-(4,5 Dimethylthiazol-2-Yl)-2,5-Diphenyltetrazolium Bromide) MTT استفاده گردید. پس از 48 ساعت تیمار با عصاره هیدروالکلی گل گیاه قاصدک محیط کشت سلول‏ها با 20 میکرولیتر محلول MTT (سیگما) با غلظت 5 میلی‏گرم به‏ازای هر میلی‏لیتر که به‏صورت تازه تهیه شده بود تعویض شد. بعد از 4 ساعت انکوباسیون در 37 درجه سانتی‏گراد محلول روی سلول‏ها به آهستگی حذف شد و کریستال‏های فورمازون ایجاد شده در اثر واکنش با MTT در 100 میکرولیتر DMSO حل شد. پس از چند دقیقه انکوباسیون در دمای اتاق و حل شدن کامل کریستال‏ها، جذب در 570 نانومتر توسط دستگاه الایزا (BioTek) محاسبه شد.

Real-time PCR: برای بررسی مقایسه‏ای بیان ژن‌ Sox2 و ژن β-2M به‏عنوان کنترل داخلی در گروه کنترل و سلول‏های تیمار شده با 800 میکرو گرم بر میلی‏لیتر عصاره گل قاصدک از تکنیک Real-time PCR استفاده شد. برای این منظور سلول‏ها در پاساژ سوم برای آزمون انتخاب شدند. در این تکنیک استخراج RNA کل از سلول‏ها با استفاده از کیت Pure link RNA mini kit ( Invitrogen ) و دستورات شرکت سازنده انجام گرفت و با استفاده از آنزیم کپی برداری معکوس به cDNA تبدیل شد. در مطالعه حاضر، جهت ساخت cDNA از پرایمر oligo dT موجود در کیتRevert aid H Minus-First Strand cDNA Synthesis, K1632  مربوط به شرکت Fermentas استفاده شده است و مطابق با دستور شرکت سازنده mRNA به cDNA تبدیل شد. 500 نانوگرم cDNA برای تعیین کمیت بیان mRNA ژن Sox2 استفاده شد. تمامی پرایمرها در جدول شماره یک طبقه بندی شده‏اند. واکنش‏های PCR در حجم 25 میکرولیتر (Sybergreen) و در 40 چرخه توسط دستگاه (Applied Biosystem cycler) انجام گردید آنالیز نسبی در سطح mRNA با روش Pfaff1 و با استفاده از فرمول ((ΔCT نمونه هدف) – (ΔCT کالیبره کننده)) = ΔΔCT انجام شد. ΔCT عبارت است از CT ژن هدف (یا کالیبراتور) که از CT ژن خانه‌زاد کسر شده است. این عدد بازگو می‌کند که تیمار ما موجب افزایش چند برابری ساخت mRNA هدف شده است (10).

 

 

جدول 1: توالی پرایمرهای مورد استفاده در Real-time PCR

Size (bp)

Anti-sense 5 → 3

Sense 5 → 3

Accession no.

Gene

197

CTGGCGGAGAATAGTTGGGG

TGCCTCTTTAAGACTAGGGCTG

NM_001109181

Sox2

243

TTACATGTCTCGGTCCCAGGTG

CCCAACTTCCTCAACTGCTACG

NM_012512

B2M

 

 

آنالیز آماری:

آنالیز آماری با استفاده از نرم افزار SPSS 15.0 انجام گردید و تمامی داده‏ها به‏صورت ± SEM  Meanارائه شد. مقایسه آماری بین گروه‏ها با استفاده از Tukey's post hoc test انجام شد و  05/0P < معنی‏دار در نظر گرفته شد.

 

نتایج

نتایج حاصل از کشت سلول‏های بنیادی عصبی

سلول‏ها وقتی در محیط مناسب کشت سلول بنیادی عصبی قرار گرفتند زوائد و استطاله‏هایی در سلول ایجاد گردید که گاهی چند برابر جسم سلولی مشاهده شد و با سلول‏های جانبی ارتباط برقرار نمود هسته‏ها کشیده‏تر به‏نظر می‏رسید و سلول‏ها دوکی‏تر شده و در حالی‏که مرز بین سلول‏ها منظم‏تر و مشخص‏تر دیده شد. در روز اول ابتدا این سلول‏ها به‏صورت کلونی بودند که به کف پلیت چسبیده‏اند در روز دوم و سوم به مرور از حجم کلونی کاسته شد و سلول‏ها کم کم پخش شدند و این در حالی بود که همچنان سلول‏ها قدرت تقسیم داشتند به این ترتیب تا حدودی ظاهر سلول‏ها ویژگی‏های یک سلول شبه عصبی را به‏دست آوردند که قدرت تقسیم داشتند. سلول‏های بنیادی عصبی بعد از 7 روز کاملا فلاسک را پر کردند و نمایی کشیده و دوکی شکل با زوائد سیتوپلاسمی به خود گرفتند (شکل 1  AوB). این سلول‏ها  قدرت تکثیر داشتند که برای اثبات عصبی بودن سلول‏های NSCs و تعیین خلوص آن‏ها در پاساژ سوم از آنتی‏بادی Nestin استفاده گردید. در سلول‏هایی که پروتئین مربوطه وجود داشت به‏دلیل استفاده از آنتی‏بادی ثانویه کنژوکه به FITC سیتوپلاسمشان سبز رنگ دیده شد. برای تعیین درصد سلول‏های مثبت، هسته سلول‏ها توسط اتیدیوم بروماید قرمز رنگ شدند (شکل 1 C و D). میانگین درصد سلول‏های مثبت برای پروتئین نستین 46/ 0± 12/95 ارزیابی شد.

 

 

 

شکل 1: سلول‏های بنیادی عصبی. ( A سلول‏های بنیادی عصبی را پس از یک روز نشان می‏دهد که به‏صورت کلونی‏های چسبیده به کف پلیت دیده می‏شود. ( Bسلول‏های بنیادی عصبی را پس از یک هفته روز نشان می‏دهد. این سلول‏ها کف فلاسک را پر کرده و حالت کشیده و دوکی شکل می‏باشند. C و D) ایمونوسیتوشیمی از سلول‏های بنیادی عصبی به‏ترتیب فاز کنتراست و فلورسنت. رنگ سبز نشان‏دهنده آنتی‏بادی نستین و رنگ قرمز اتیدیوم بروماید می‏باشد. بزرگنمایی × 200.

 

نتایج MTT

مورفولوژی سلول‏های بنیادی عصبی پس از تیمار با عصاره گیاهی تغییری نداشت. نتایج تست MTT نشان‏دهنده افزایش تکثیر سلول‏های بنیادی عصبی در گروه تیمار شده نسبت به گروه کنترل بود (شکل 2). سلول‏های تیمار شده با غلظت 800 میکروگرم (01/0±37/0) بالاترین میانگین رشد را نشان داد که نسبت به گروه کنترل (07/0±24/0) اختلاف معنی‏داری را نشان می‏دهد (05/0P <). نتایج به‏دست آمده نشان می‏دهد که افزایش سرعت تکثیر در سلول‏های بنیادی عصبی به غلظت عصاره موجود در محیط کشت دارد. غلظت‏های بالای 800 میکروگرم برای سلول‏ها توکسیک محسوب می‏شوند و کاهش تعداد سلول به‏دلیل مرگ سلول‏ها می‏باشد.

 

 

 

شکل 2 :A) نمودار مقایسه آماری سلول‏های بنیادی عصبی در غلطت‏های مختلف با روش MTT: A) نمودار نشان‏دهنده وجود اختلاف معنی‏دار میان گروه کنترل و سلول‏های بنیادی عصبی تیمار شده با غلطت 800 میکروگرم بر میلی‏لیتر می‏باشد. CوB) میکروگراف‏های سلول‏های بنیادی عصبی قبل و بعد از تیمار با غلظت800 میکروگرم بر میلی‏لیتر عصاره گل قاصدک. خطای معیار (SEM)،  نشان‏دهنده وجود اختلاف معنی‏دار با گروه کنترل (05/0P <). بزرگنمایی × 200.

 

 

نتایج حاصل از  Real –time PCR

بیان کمی mRNA ژن مربوط به رشد و تکثیر سلول‏های بنیادی عصبی که با غلظت 800 میکروگرم در میلی‏لیتر و زمان 48 ساعت تیمار شده بودند با روش Quantitative real-time RT-PCR بررسی شد. الگوی بیان کمی ژن Sox2 در شکل 3 نشان داده شده است. در این مطالعه با استفاده از روش آستانه نسبی (مقایسه نسبی) مقدار داده‏های توسط ژن B2M نرمالایز شد و با استفاده از فرمول ΔΔCT 2 (طبق مقاله Pfaffle و همکارانش) افزایش ساخت mRNA محاسبه شد. نتایج نشان داد که میزان کمی mRNA مربوط به این ژن در سلول‏های تیمار شده با عصاره گل قاصدک (07/0±73/0) نسبت به نمونه کنترل یا تیمار نشده (03/0±43/0) افزایش داشت (شکل3).

 

 

شکل 3: نمودار مقایسه نسبی بیان ژن Sox2 نرمالایز شده با ژن B2M در سلول‏های بنیادی عصبی با بهترین غلظت عصاره گل قاصدک (800 میکروگرم در میلی‏لیتر) برای مدت 48 ساعت.

 

 

بحث

نتایج حاصل از این مطالعه نشان‏دهنده تاثیر افزایش دهنده عصاره هیدروالکلی گل قاصدک در روند تکثیر سلول‏های بنیادی عصبی می‏باشد. همچنین افزایش بیان ژن Sox2 در سلول‏های بنیادی عصبی تاییدی بر نتایج MTT می‏باشد. استراتژی سلول درمانی در بیماری‏های مخرب سیستم عصبی توسط لیندوال و همکارانش (11) مطرح شد. هم اکنون سلول‏های بنیادی (سوماتیک) به‏عنوان منبع قابل دسترس و مناسب برای سلول درمانی محسوب می‏شوند. این سلول‏ها در بیشتر بافت‏های در بالغین حضور دارند (12).  هرمن و همکارانش (2) به‏منظور تایید هویت سلول‏های بنیادی عصبی ایجاد شده نشان دادند که سلول‏های بنیادی عصبی می‏توانند نسبت به نشانگر عصبی نستین واکنش مثبت نشان دهند. نتایج به‏دست آمده در این مطالعه که بر روی سلول‏های بنیادی عصبی مشتق از هیپوکمپ مغز نوزاد موش صحرایی انجام شد تاییدی بر کار هرمن و همکارانش (2) بود. سلول‏های بنیادی عصبی دارای ظرفیت خود تکثیری و تمایز به سلول‏های عصبی، آستروسیت و الیگودندروسیت هستند (13و 14و 15). در حال حاضر استفاده از عصاره‏های گیاهی در درمان بسیاری از بیماری گسترش یافته است. در طب سنتی از عصاره گیاه گل قاصدک به‏منظور ضدتهوع، ضد درد و ضدالتهاب استفاده می‏شود (16). با این‏حال در رابطه با اثر این گیاه روی سلول‏های بنیادی هیچ‏گونه مطالعه‏ای صورت نگرفته است. بیشتر بررسی‏های انجام شده در رابطه با گیاهان متعلق به رده Cirsium مربوط به گیاه Cirsium japonicum می‏باشد. این گیاه به‏عنوان داروی ضد دیابت (17)، ضد اضطراب (18) آنتی اکسیدانت و ضدسرطان (19) معرفی شده است. همچنین گزارش شده است که استفاده از عصاره این گیاه جذب گلوکز را در سلول‏های بدن افزایش می‏دهد (20). مطالعه‏ای دیگر نشان دهنده تاثیر عصاره متانولی گیاه بر روی مهار رشد و القا آپوپتوزیس در سلول‏های سرطانی پستان می‏باشد (21). همچنین مطالعات نشان می‏دهد که عصاره متانولی این گیاه تاثیر قابل توجهی بر روی چرخه دو رده سلولی K562 و سلول‏های Jurkat ندارد (22). با توجه به بررسی‏های انجام شده، این تحقیق اولین مطالعه بر روی تاثیر عصاره گل قاصدک در تکثیر سلول‏های بنیادی عصبی می‏باشد. نتایج به‏دست آمده نشان می‏دهد که تیمار سلول‏های بنیادی عصبی با غلظت 800میکروگرم بر میلی‏لیتر باعث افزایش معنیدار در رشد و تکثیر این سلول‏ها میشود. مطالعات انجام شده توسط محققین نشان داده است که عصاره گل قاصدک دارای خاصیت ضدالتهابی می‏باشد (3و 16). بنابراین با توجه به نتایج به‏دست آمده از این تحقیق و با در نظر گرفتن خاصیت ضدالتهابی می‏توان به تاثیرات مثبت استفاده از این گیاه در درمان بیماری‏های مخرب سیستم عصبی از قبیل  آسیب‏های نخاعی به‏ویژه در فاز اولیه امیدوار بود.

 

نتیجه گیری

با توجه به نتایج به دست آمده عصاره گیاه Cirsium vulgare  می‏تواند ماده موثری برای افزایش تکثیر سلول‏های بنیادی عصبی در محیط In vitro  باشد.

 

تشکر و قدردانی

این تحقیق در آزمایشگاه سلول‏های بنیادی دانشگاه آزاد اسلامی واحد اردبیل انجام شده است. لذا لازم می‏دانیم از حمایت‏های بی‏دریغ جناب آقای دکتر سید سعید هاشمین (معاون پژوهشی دانشگاه آزاد اسلامی واحد اردبیل) نهایت تقدیر و سپاس را داشته باشیم. 

Aim: In vitro investigation of hydroethanolic extraction of Cirsium vulgare on growth rates of neonate rat neural stem cells.

Material and Methods: Neural stem cells were isolated from hippocampus of neonatal rat brain. To determine optimal concentration of Cirsium vulgare extraction, isolated neural stem cells were treated with 200, 400, 600, 800 and 1000 µg/ml for 48 h and then cells proliferation rate were evaluated by MTT assay. In addition Sox2 mRNA expression in neural stem cells was evaluated using quantitative real-time PCR.

Results: The results of this study showed that the Cirsium vulgare extract caused significant increase in cell proliferative activity and Sox2 mRNA expression when compared with the control group.

Conclusion: with respect to the effect of Cirsium vulgare extract on the proliferation rate of neural stem cells, the use of hydroethanolic extraction of Cirsium vulgare can be used for clinical purposes to treat some of the neurodegenerative disorders such as ischemic stroke and spinal cord injury.

Key words: Cell proliferation, Cirsium vulgare, Neural stem cells